Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24772
Trapped Gene
Msln (ENSMUSG00000063011)
Vector Insertion
Chr 17: 25889320 - 25889886
Public Clones IST11609A11 (tigm)
Private Clones OST207285 (lexicon)
Severity of mutation (?) Insertion after 16% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000495493 (Chr17:25889887..25890007 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTACACTCCGGGGACATCA Chr17:25889888..25889907 60.19 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000495493 (Chr17:25889887..25890007 -)
Downstram Exon
ENSMUSE00000517025 (Chr17:25889234..25889319 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTACACTCCGGGGACATCA Chr17:25889888..25889907 60.19 50 ATTCAGTTCCTCGTCGGTGA Chr17:25889244..25889263 60.66 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000503651 Chr17:25891077..25891322 CAAACAGTGGTGTGGGTTGA Chr17:25891211..25891230 60.45 50
upstream ENSMUSE00000489384 Chr17:25890719..25890762 No primer for this exon
upstream ENSMUSE00000490311 Chr17:25890323..25890369 CACTCCTCCATGCTGTGAAC Chr17:25890343..25890362 59.26 55
upstream ENSMUSE00000495493 Chr17:25889887..25890007 ATTACACTCCGGGGACATCA Chr17:25889888..25889907 60.19 50

*** Putative Vector Insertion (Chr 17: 25889320 - 25889886) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000517025 Chr17:25889234..25889319 ATTCAGTTCCTCGTCGGTGA Chr17:25889244..25889263 60.66 50
downstream ENSMUSE00000520983 Chr17:25888801..25888930 GAGACCTCCGTGGGAGTACA Chr17:25888820..25888839 60.11 60
downstream ENSMUSE00000461576 Chr17:25888515..25888708 TGGGTTCTTCCACTCCTCAG Chr17:25888499..25888518 60.23 55
downstream ENSMUSE00000508867 Chr17:25888198..25888288 GATGCTCTGGACGATGGACT Chr17:25888182..25888201 60.23 55
downstream ENSMUSE00000510649 Chr17:25888024..25888123 GGGTGTATGACGGTCAGCTT Chr17:25888025..25888044 60 55
downstream ENSMUSE00000516037 Chr17:25887620..25887798 AGCATGGTGCCATCTACACA Chr17:25887677..25887696 60.14 50
downstream ENSMUSE00000514778 Chr17:25887204..25887359 TCCACTGGTGGATGTCTTCA Chr17:25887250..25887269 60.09 50
downstream ENSMUSE00000475026 Chr17:25886976..25887118 GAAGATAGCAGGCGACCAAG Chr17:25887069..25887088 59.98 55
downstream ENSMUSE00000477064 Chr17:25886771..25886898 TTCTAGGCCGCTCACATTCT Chr17:25886777..25886796 59.98 50
downstream ENSMUSE00000479087 Chr17:25886394..25886488 ACCTGCAGCCTCTTGAAAGT Chr17:25886385..25886404 59.09 50
downstream ENSMUSE00000464850 Chr17:25885846..25886032 ACGGACAGGGCTTTTATCCT Chr17:25885927..25885946 59.96 50
downstream ENSMUSE00000465986 Chr17:25885559..25885775 AGGGAGCATATGCCACTGTT Chr17:25885539..25885558 59.58 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTACACTCCGGGGACATCA Chr17:25889886..25889906 60.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ATTACACTCCGGGGACATCA Chr17:25889886..25889906 60.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTCCAGAGGGACAGTGTTGG Chr17:25890031..25890051 61.1 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTCCAGAGGGACAGTGTTGG Chr17:25890031..25890051 61.1 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063011