Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24798
Trapped Gene
Mpnd (ENSMUSG00000003199)
Vector Insertion
Chr 17: 56149010 - 56149699
Public Clones not available
Private Clones OST206190 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657168 (Chr17:56148944..56149009 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657168 (Chr17:56148944..56149009 +)
Downstram Exon
ENSMUSE00000139299 (Chr17:56149700..56149936 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000694314 Chr17:56148640..56148679 No primer for this exon
upstream ENSMUSE00000407258 Chr17:56148753..56149009 No primer for this exon
upstream ENSMUSE00000657170 Chr17:56148804..56148860 No primer for this exon
upstream ENSMUSE00000657169 Chr17:56148862..56148942 No primer for this exon
upstream ENSMUSE00000657168 Chr17:56148944..56149009 No primer for this exon

*** Putative Vector Insertion (Chr 17: 56149010 - 56149699) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139299 Chr17:56149700..56149936 No primer for this exon
downstream ENSMUSE00000139289 Chr17:56150411..56150534 No primer for this exon
downstream ENSMUSE00000139290 Chr17:56151041..56151122 No primer for this exon
downstream ENSMUSE00000298613 Chr17:56151289..56151385 No primer for this exon
downstream ENSMUSE00000139301 Chr17:56151694..56151766 No primer for this exon
downstream ENSMUSE00000139296 Chr17:56151839..56151915 No primer for this exon
downstream ENSMUSE00000298545 Chr17:56154364..56154532 No primer for this exon
downstream ENSMUSE00000298515 Chr17:56154631..56154701 No primer for this exon
downstream ENSMUSE00000139293 Chr17:56154894..56154983 No primer for this exon
downstream ENSMUSE00000139298 Chr17:56155327..56155419 No primer for this exon
downstream ENSMUSE00000345936 Chr17:56155939..56156082 No primer for this exon
downstream ENSMUSE00000707044 Chr17:56155939..56156025 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACCGTTCATGTCCTCCACTG Chr17:56149028..56149048 60.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACCGTTCATGTCCTCCACTG Chr17:56149028..56149048 60.99 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000003199