Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24801
Trapped Gene
Zbtb33 (ENSMUSG00000048047)
Vector Insertion
Chr X: 35543260 - 35545391
Public Clones not available
Private Clones OST205854 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000359219 (ChrX:35542970..35543259 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCGGAGCTCTACCAAGAGAA ChrX:35543237..35543256 59.57 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000359219 (ChrX:35542970..35543259 +)
Downstram Exon
ENSMUSE00000347165 (ChrX:35545392..35550223 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCGGAGCTCTACCAAGAGAA ChrX:35543237..35543256 59.57 55 TTACAGGGGGCGAGTTATTG ChrX:35546120..35546139 59.95 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000359219 ChrX:35542970..35543259 CCGGAGCTCTACCAAGAGAA ChrX:35543237..35543256 59.57 55
upstream ENSMUSE00000701813 ChrX:35542970..35543085 GACATTTAAAGCGGCAGCAG ChrX:35542982..35543001 60.9 50

*** Putative Vector Insertion (Chr X: 35543260 - 35545391) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000347165 ChrX:35545392..35550223 TTACAGGGGGCGAGTTATTG ChrX:35546120..35546139 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCCCCTTCTCTGTCCAGT ChrX:35543275..35543295 60.5 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTCCCCTTCTCTGTCCAGT ChrX:35543275..35543295 60.5 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000048047