Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24806
Trapped Gene
Eif2s3x (ENSMUSG00000035150)
Vector Insertion
Chr X: 91436262 - 91441610
Public Clones not available
Private Clones OST205569 (lexicon)
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000550115 (ChrX:91441611..91441783 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTGCAGTCAAGGCTGATTTG ChrX:91441694..91441713 59.44 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000550115 (ChrX:91441611..91441783 -)
Downstram Exon
ENSMUSE00000362509 (ChrX:91434055..91436261 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTGCAGTCAAGGCTGATTTG ChrX:91441694..91441713 59.44 50 GGAATGGGCACACAACTTCT ChrX:91434702..91434721 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000361268 ChrX:91457904..91457990 CATCTTTCCCGACAGGATCT ChrX:91457914..91457933 59.09 50
upstream ENSMUSE00000709653 ChrX:91457904..91457990 CATCTTTCCCGACAGGATCT ChrX:91457914..91457933 59.09 50
upstream ENSMUSE00000550137 ChrX:91457058..91457121 No primer for this exon
upstream ENSMUSE00000393550 ChrX:91454875..91455002 AATTGGTCACGTAGCTCATGG ChrX:91454978..91454998 60.01 47.62
upstream ENSMUSE00000550131 ChrX:91454668..91454789 AGCAGCACACCAGATGAGTTT ChrX:91454712..91454732 59.93 47.62
upstream ENSMUSE00000407988 ChrX:91450388..91450482 TTTGATGGCTACGATGCTGA ChrX:91450427..91450446 60.37 45
upstream ENSMUSE00000550126 ChrX:91449289..91449447 ACACCTGGCTGCCATAGAAA ChrX:91449391..91449410 60.66 50
upstream ENSMUSE00000550122 ChrX:91448153..91448287 TACTTCAGAGCCCCGTCTCA ChrX:91448156..91448175 60.93 55
upstream ENSMUSE00000550121 ChrX:91446229..91446323 GGGAGGTGTAGCTGGTGGTA ChrX:91446252..91446271 59.99 60
upstream ENSMUSE00000550119 ChrX:91445053..91445197 GAGACCCGGTATTGTCTCCA ChrX:91445158..91445177 59.93 55
upstream ENSMUSE00000697454 ChrX:91444980..91445197 GAGACCCGGTATTGTCTCCA ChrX:91445158..91445177 59.93 55
upstream ENSMUSE00000300442 ChrX:91442627..91442796 AAAGATCGACCCCACCTTGT ChrX:91442767..91442786 60.75 50
upstream ENSMUSE00000550115 ChrX:91441611..91441783 GTGCAGTCAAGGCTGATTTG ChrX:91441694..91441713 59.44 50

*** Putative Vector Insertion (Chr X: 91436262 - 91441610) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000362509 ChrX:91434055..91436261 GGAATGGGCACACAACTTCT ChrX:91434702..91434721 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGAAACACTGGCGGTAAG ChrX:91438604..91438624 58.92 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGAATGTTTGGCATTTTTCC ChrX:91438587..91438608 59.8 33.33 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035150