Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24812
Trapped Gene
Bcas2 (ENSMUSG00000005687)
Vector Insertion
Chr 3: 102977269 - 102978262
Public Clones not available
Private Clones OST205202 (lexicon)
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000317585 (Chr3:102977198..102977268 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000317585 (Chr3:102977198..102977268 +)
Downstram Exon
ENSMUSE00000317576 (Chr3:102978263..102978424 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000379879 Chr3:102975672..102975788 No primer for this exon
upstream ENSMUSE00000317594 Chr3:102975871..102975963 No primer for this exon
upstream ENSMUSE00000317585 Chr3:102977198..102977268 No primer for this exon

*** Putative Vector Insertion (Chr 3: 102977269 - 102978262) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000317576 Chr3:102978263..102978424 No primer for this exon
downstream ENSMUSE00000173608 Chr3:102979542..102979592 No primer for this exon
downstream ENSMUSE00000173606 Chr3:102981262..102981342 No primer for this exon
downstream ENSMUSE00000518364 Chr3:102982278..102982750 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAACAGCTGCTTTGCCAGTG Chr3:102977292..102977312 60.19 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAACAGCTGCTTTGCCAGTG Chr3:102977292..102977312 60.19 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000005687