Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24845
Trapped Gene
Prosapip1 (ENSMUSG00000037703)
Vector Insertion
Chr 2: 130463832 - 130468456
Public Clones not available
Private Clones OST203925 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000641086 (Chr2:130468457..130468580 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000641086 (Chr2:130468457..130468580 -)
Downstram Exon
ENSMUSE00000683286 (Chr2:130463621..130463831 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon AACCAAGCCATCCCGTACTA Chr2:130463730..130463749 59.45 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641086 Chr2:130468457..130468580 No primer for this exon

*** Putative Vector Insertion (Chr 2: 130463832 - 130468456) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000641085 Chr2:130463621..130463783 TTTGGACTAGCCAACCAAGC Chr2:130463718..130463737 60.25 50
downstream ENSMUSE00000683286 Chr2:130463621..130463831 AACCAAGCCATCCCGTACTA Chr2:130463730..130463749 59.45 50
downstream ENSMUSE00000683285 Chr2:130463021..130463155 AGGTAACGTCTCCAGCTTCG Chr2:130463092..130463111 59.5 55
downstream ENSMUSE00000558822 Chr2:130462679..130463155 GAGAGTTGGCGAGAACCTTG Chr2:130462827..130462846 59.99 55
downstream ENSMUSE00000259186 Chr2:130461509..130462363 GGTCATGGTCCGAGACTTGT Chr2:130462180..130462199 59.97 55
downstream ENSMUSE00000458806 Chr2:130458575..130461200 GACATTGGTGACTCCGACCT Chr2:130460420..130460439 59.97 55
downstream ENSMUSE00000558820 Chr2:130458508..130461200 GACATTGGTGACTCCGACCT Chr2:130460420..130460439 59.97 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCACAGCTTTAATCGCCTTG Chr2:130465394..130465414 60.9 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGGACTCTGAGGCAGTGAGTA Chr2:130465452..130465473 60.6 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037703