Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2486
Trapped Gene
Tsn (ENSMUSG00000026374)
Vector Insertion
Chr 1: 120197615 - 120201267
Public Clones XT0555 (sanger) XT0554 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 67% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000158524 (Chr1:120201268..120201347 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAACCAGATCGGGAAAAAG Chr1:120201327..120201346 60.04 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000158524 (Chr1:120201268..120201347 -)
Downstram Exon
ENSMUSE00000659655 (Chr1:120194732..120197614 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAACCAGATCGGGAAAAAG Chr1:120201327..120201346 60.04 45 CAGCTCAGGCTTACCACTCC Chr1:120194822..120194841 60.01 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000692745 Chr1:120207578..120207747 CTGTGAGCGAGATCTTCGTG Chr1:120207620..120207639 59.73 55
upstream ENSMUSE00000540365 Chr1:120206350..120206443 TACTTCAAGGGGTCCACCAG Chr1:120206369..120206388 59.96 55
upstream ENSMUSE00000158525 Chr1:120205322..120205418 AGGTGCTTGAAAGCGAGAGA Chr1:120205391..120205410 60.28 50
upstream ENSMUSE00000158528 Chr1:120201777..120201892 CCCGAGAGGCTGTTACAGAG Chr1:120201787..120201806 60.01 60
upstream ENSMUSE00000158524 Chr1:120201268..120201347 TGAACCAGATCGGGAAAAAG Chr1:120201327..120201346 60.04 45

*** Putative Vector Insertion (Chr 1: 120197615 - 120201267) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000659655 Chr1:120194732..120197614 CAGCTCAGGCTTACCACTCC Chr1:120194822..120194841 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGCTTGAACCTGAGCACT Chr1:120198234..120198254 60.59 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGCTTGAACCTGAGCACT Chr1:120198234..120198254 60.59 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026374