Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24869
Trapped Gene
Mcf2 (ENSMUSG00000031139)
Vector Insertion
Chr X: 57406168 - 57408779
Public Clones not available
Private Clones OST202783 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000432513 (ChrX:57408780..57408894 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAAAGGACAATGCTTGGATCA ChrX:57408865..57408885 60.07 42.86 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000432513 (ChrX:57408780..57408894 -)
Downstram Exon
ENSMUSE00000432509 (ChrX:57406077..57406167 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAAAGGACAATGCTTGGATCA ChrX:57408865..57408885 60.07 42.86 TTGAGGGAAGCCCATGTATC ChrX:57406077..57406096 59.89 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000432522 ChrX:57431759..57432083 ACTGTTCTTTCGTGCCGTTC ChrX:57431871..57431890 60.3 50
upstream ENSMUSE00000432518 ChrX:57413404..57413472 GCTGCTCCTCCAGTTAAAGG ChrX:57413446..57413465 59.08 55
upstream ENSMUSE00000432513 ChrX:57408780..57408894 GAAAGGACAATGCTTGGATCA ChrX:57408865..57408885 60.07 42.86

*** Putative Vector Insertion (Chr X: 57406168 - 57408779) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000432509 ChrX:57406077..57406167 TTGAGGGAAGCCCATGTATC ChrX:57406077..57406096 59.89 50
downstream ENSMUSE00000655612 ChrX:57400651..57400857 TGCCATCTCGCCTATACACA ChrX:57400674..57400693 60.24 50
downstream ENSMUSE00000206759 ChrX:57389431..57389550 CCTGGCTAAATCGAAATCCA ChrX:57389432..57389451 60.03 45
downstream ENSMUSE00000206765 ChrX:57388556..57388672 GGGGTTAACTGCTTGTCATCA ChrX:57388589..57388609 59.99 47.62
downstream ENSMUSE00000312667 ChrX:57386785..57386934 GTGATACCTTTCGGCTCGAC ChrX:57386772..57386791 59.7 55
downstream ENSMUSE00000206762 ChrX:57383221..57383354 GTTTGCCAGTCGCCATTTAT ChrX:57383208..57383227 59.97 45
downstream ENSMUSE00000206771 ChrX:57382474..57382588 TCCATATCATGCACCTGAGC ChrX:57382540..57382559 59.63 50
downstream ENSMUSE00000206769 ChrX:57380193..57380312 No primer for this exon
downstream ENSMUSE00000206758 ChrX:57377886..57378077 CAGCTTGTGGCCACGTAGTA ChrX:57378008..57378027 59.93 55
downstream ENSMUSE00000206756 ChrX:57376293..57376484 ATTCCCCTTGATCACAGCAC ChrX:57376435..57376454 59.93 50
downstream ENSMUSE00000206767 ChrX:57374117..57374288 TATCATTCTGGACCGCATCA ChrX:57374114..57374133 60.03 45
downstream ENSMUSE00000553438 ChrX:57372266..57372313 No primer for this exon
downstream ENSMUSE00000206764 ChrX:57368280..57368323 TGAGCGTGAATCTGTCTCCA ChrX:57368271..57368290 60.56 50
downstream ENSMUSE00000206755 ChrX:57366556..57366635 GCTATCCTCAACGGCTTCAA ChrX:57366593..57366612 60.35 50
downstream ENSMUSE00000206770 ChrX:57363745..57363811 No primer for this exon
downstream ENSMUSE00000206760 ChrX:57362933..57363048 TCTCAGGAGAGGTGGCATAAG ChrX:57362967..57362987 59.44 52.38
downstream ENSMUSE00000206768 ChrX:57362594..57362663 GCAAGGTCCCACTCTTTCTG ChrX:57362584..57362603 59.84 55
downstream ENSMUSE00000312567 ChrX:57360633..57360725 TGGAAAAAGGCACATTCAGA ChrX:57360612..57360631 59.25 40
downstream ENSMUSE00000312555 ChrX:57337578..57337670 TCGTTGAACAGGTTTGAGCA ChrX:57337583..57337602 60.43 45
downstream ENSMUSE00000401939 ChrX:57336036..57336161 CCATTGATGGCAGTCTGATG ChrX:57336021..57336040 60.07 50
downstream ENSMUSE00000312530 ChrX:57330358..57330579 CGGTGTCCTAGCCAAACATT ChrX:57330493..57330512 59.99 50
downstream ENSMUSE00000312521 ChrX:57320332..57320424 TTTGCGGTTATCACCTTTCA ChrX:57320355..57320374 59.16 40
downstream ENSMUSE00000312515 ChrX:57317774..57317852 No primer for this exon
downstream ENSMUSE00000312507 ChrX:57316271..57316334 CCTGATCCTGCTGGGTTTTA ChrX:57316292..57316311 60.07 50
downstream ENSMUSE00000312498 ChrX:57315257..57315399 TGGCGTTGAAAAGAGTTTCC ChrX:57315325..57315344 60.23 45
downstream ENSMUSE00000312489 ChrX:57313024..57313130 No primer for this exon
downstream ENSMUSE00000655610 ChrX:57309135..57309867 TAAAGGAGCGCTGGGTCTAA ChrX:57309393..57309412 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATTTCCTAATCGCCTTGC ChrX:57408716..57408736 58.34 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAGTAATTGCAAAAGTGCTC ChrX:57408801..57408823 58.08 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031139