Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24881
Trapped Gene
Rfx7 (ENSMUSG00000037674)
Vector Insertion
Chr 9: 72439641 - 72441044
Public Clones not available
Private Clones OST202450 (lexicon) OST103473 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000311426 (Chr9:72439558..72439640 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTCAACTGCCTTCTGGTC Chr9:72439602..72439621 59.84 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000311426 (Chr9:72439558..72439640 +)
Downstram Exon
ENSMUSE00000311403 (Chr9:72441045..72441167 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTCAACTGCCTTCTGGTC Chr9:72439602..72439621 59.84 55 CTGTGCCCGACTAGATGACA Chr9:72441081..72441100 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000506465 Chr9:72380047..72380787 GAGAGGAACCGTGACGAGAG Chr9:72380371..72380390 59.99 60
upstream ENSMUSE00000311445 Chr9:72424846..72424879 No primer for this exon
upstream ENSMUSE00000311426 Chr9:72439558..72439640 CCTTCAACTGCCTTCTGGTC Chr9:72439602..72439621 59.84 55

*** Putative Vector Insertion (Chr 9: 72439641 - 72441044) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000311403 Chr9:72441045..72441167 CTGTGCCCGACTAGATGACA Chr9:72441081..72441100 59.85 55
downstream ENSMUSE00000583990 Chr9:72455430..72455546 TTTTTCCAAAGTCAGCAGCA Chr9:72455488..72455507 59.58 40
downstream ENSMUSE00000583989 Chr9:72458111..72458195 AAAGTCAAGGTTGGGCAGTG Chr9:72458180..72458199 60.15 50
downstream ENSMUSE00000407498 Chr9:72459428..72459635 GCCATTGACTTGGTGCCTAT Chr9:72459606..72459625 59.96 50
downstream ENSMUSE00000583988 Chr9:72462844..72463139 CGTTGGCTGTAGTGCCTTCT Chr9:72463053..72463072 60.45 55
downstream ENSMUSE00000583987 Chr9:72464444..72470744 ACCACGCTCCTTCTTTCTCA Chr9:72470378..72470397 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000037674