Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24886
Trapped Gene
Wdr76 (ENSMUSG00000027242)
Vector Insertion
Chr 2: 121352782 - 121354546
Public Clones not available
Private Clones OST202277 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000167287 (Chr2:121352738..121352781 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACCAAGAAGGGGCTGTCTA Chr2:121352752..121352771 59.28 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000167287 (Chr2:121352738..121352781 +)
Downstram Exon
ENSMUSE00000167291 (Chr2:121354547..121354700 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACCAAGAAGGGGCTGTCTA Chr2:121352752..121352771 59.28 55 GGAGATTGCTCCTTTGGTCA Chr2:121354622..121354641 60.19 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641680 Chr2:121332459..121332599 GATCGCTTAAAGGGCTAGGG Chr2:121332470..121332489 60.18 55
upstream ENSMUSE00000395929 Chr2:121332519..121332584 CTGGAAGGTCCTCCTGTCTG Chr2:121332542..121332561 59.83 60
upstream ENSMUSE00000684575 Chr2:121335584..121335671 GGTCCAAGGCTGAATCTGAG Chr2:121335616..121335635 59.8 55
upstream ENSMUSE00000167299 Chr2:121336275..121336661 AAAGCAGCGACGAAGACAGT Chr2:121336630..121336649 60.2 50
upstream ENSMUSE00000684574 Chr2:121336275..121336661 AAAGCAGCGACGAAGACAGT Chr2:121336630..121336649 60.2 50
upstream ENSMUSE00000167289 Chr2:121343441..121343533 No primer for this exon
upstream ENSMUSE00000641678 Chr2:121343954..121344001 ACACTTGTGAGCCTGCTGGT Chr2:121343954..121343973 60.93 55
upstream ENSMUSE00000397606 Chr2:121345154..121345209 GCTCCGTGGGATGATAAAGA Chr2:121345165..121345184 60.04 50
upstream ENSMUSE00000354245 Chr2:121351188..121351317 ATTGGATGTCGAAGGTCCAT Chr2:121351216..121351235 59.22 45
upstream ENSMUSE00000167293 Chr2:121352538..121352639 TGAAGACATGGGCAGAGATG Chr2:121352614..121352633 59.79 50
upstream ENSMUSE00000167287 Chr2:121352738..121352781 GACCAAGAAGGGGCTGTCTA Chr2:121352752..121352771 59.28 55

*** Putative Vector Insertion (Chr 2: 121352782 - 121354546) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000167291 Chr2:121354547..121354700 GGAGATTGCTCCTTTGGTCA Chr2:121354622..121354641 60.19 50
downstream ENSMUSE00000355947 Chr2:121357022..121357177 AACACAGCGCTGGAAAAATC Chr2:121357173..121357192 60.26 45
downstream ENSMUSE00000641674 Chr2:121357473..121357496 GGCTTCTTGGTCAGACCCTA Chr2:121357496..121357515 59.28 55
downstream ENSMUSE00000597537 Chr2:121359844..121360058 CCCACTAGCAGACTGGAGGA Chr2:121359917..121359936 60.4 60
downstream ENSMUSE00000597536 Chr2:121361160..121361312 CAATGCTTTTCGAGTGCTCA Chr2:121361248..121361267 60.13 45
downstream ENSMUSE00000597535 Chr2:121362843..121362896 GGGAAGATATGGAGCTGCTG Chr2:121362874..121362893 59.8 55
downstream ENSMUSE00000597534 Chr2:121368037..121370593 ATAATGGCGCAAGGTCAAAC Chr2:121369269..121369288 59.97 45
downstream ENSMUSE00000684555 Chr2:121368037..121370596 ATAATGGCGCAAGGTCAAAC Chr2:121369269..121369288 59.97 45
downstream ENSMUSE00000684561 Chr2:121368037..121368745 CACATTCTTTCCCGACTCGT Chr2:121368175..121368194 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGACCAAGAAGGGGCTGT Chr2:121352750..121352770 60.63 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTTTGCGTGACTGGGAAAA Chr2:121352827..121352847 60.67 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027242