Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24888
Trapped Gene
Egln2 (ENSMUSG00000058709)
Vector Insertion
Chr 7: 27950748 - 27951334
Public Clones (sanger) IST14710F10 (tigm)
Private Clones OST202215 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000676552 (Chr7:27951335..27951432 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCTGGCAGGACCTCCCTTC Chr7:27951342..27951361 63.45 65 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000676552 (Chr7:27951335..27951432 -)
Downstram Exon
ENSMUSE00000711645 (Chr7:27949639..27950747 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCTGGCAGGACCTCCCTTC Chr7:27951342..27951361 63.45 65 TCTACCCAGGCAATCTGGTC Chr7:27949729..27949748 60.07 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000510361 Chr7:27951703..27951774 No primer for this exon
upstream ENSMUSE00000676552 Chr7:27951335..27951432 GTCTGGCAGGACCTCCCTTC Chr7:27951342..27951361 63.45 65

*** Putative Vector Insertion (Chr 7: 27950748 - 27951334) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000516047 Chr7:27949639..27950747 TCTACCCAGGCAATCTGGTC Chr7:27949729..27949748 60.07 55
downstream ENSMUSE00000711645 Chr7:27949639..27950747 TCTACCCAGGCAATCTGGTC Chr7:27949729..27949748 60.07 55
downstream ENSMUSE00000514070 Chr7:27945307..27945426 GTCAACATGCCTCACGTACC Chr7:27945351..27945370 59.01 55
downstream ENSMUSE00000473878 Chr7:27944806..27944942 AAATGAGCAACCGGTCAAAG Chr7:27944836..27944855 60.11 45
downstream ENSMUSE00000472068 Chr7:27944543..27944610 No primer for this exon
downstream ENSMUSE00000676551 Chr7:27944007..27944230 AACACCTTTCTGTCCCGATG Chr7:27944189..27944208 59.97 50
downstream ENSMUSE00000493349 Chr7:27943678..27944230 AACACCTTTCTGTCCCGATG Chr7:27944189..27944208 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTAATCGCCTTGCAGCACAT Chr7:27951264..27951284 61.32 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAGTAGGCTTCCTCCCGTAG Chr7:27951298..27951319 62.34 61.9 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GTCGGACTCTGCTCTCGGTA Chr7:27951380..27951400 60.56 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000058709