Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24899
Trapped Gene
Adal (ENSMUSG00000027259)
Vector Insertion
Chr 2: 120968259 - 120968391
Public Clones not available
Private Clones OST201748 (lexicon) OST186061 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000428745 (Chr2:120968260..120968390 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCATGATTGACAAGGGGAAG Chr2:120968354..120968373 60.31 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000428745 (Chr2:120968260..120968390 +)
Downstram Exon
ENSMUSE00000684870 (Chr2:120968260..120968390 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCATGATTGACAAGGGGAAG Chr2:120968354..120968373 60.31 50 CTTCCCCTTGTCAATCATGG Chr2:120968376..120968395 60.31 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000428735 Chr2:120966168..120966402 CATGACGAGAAGGTGCTCAG Chr2:120966334..120966353 59.57 55
upstream ENSMUSE00000684856 Chr2:120966175..120966345 No primer for this exon
upstream ENSMUSE00000716436 Chr2:120966234..120966345 No primer for this exon
upstream ENSMUSE00000716655 Chr2:120966235..120966402 CATGACGAGAAGGTGCTCAG Chr2:120966334..120966353 59.57 55
upstream ENSMUSE00000167514 Chr2:120967829..120968039 GTTTATCGTCCAAGCCGAGA Chr2:120967923..120967942 60.21 50
upstream ENSMUSE00000708053 Chr2:120967829..120968039 GTTTATCGTCCAAGCCGAGA Chr2:120967923..120967942 60.21 50
upstream ENSMUSE00000712001 Chr2:120967877..120968039 GTTTATCGTCCAAGCCGAGA Chr2:120967923..120967942 60.21 50
upstream ENSMUSE00000714089 Chr2:120967877..120968039 GTTTATCGTCCAAGCCGAGA Chr2:120967923..120967942 60.21 50

*** Putative Vector Insertion (Chr 2: 120968259 - 120968391) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000428745 Chr2:120968260..120968390 CTTCCCCTTGTCAATCATGG Chr2:120968376..120968395 60.31 50
downstream ENSMUSE00000684870 Chr2:120968260..120968390 CTTCCCCTTGTCAATCATGG Chr2:120968376..120968395 60.31 50
downstream ENSMUSE00000561271 Chr2:120968885..120968945 CATCAGGATGTCCTCAGCACT Chr2:120968947..120968967 60.28 52.38
downstream ENSMUSE00000684855 Chr2:120968885..120968958 CATCAGGATGTCCTCAGCACT Chr2:120968947..120968967 60.28 52.38
downstream ENSMUSE00000721328 Chr2:120968885..120968945 CATCAGGATGTCCTCAGCACT Chr2:120968947..120968967 60.28 52.38
downstream ENSMUSE00000721970 Chr2:120968885..120968945 CATCAGGATGTCCTCAGCACT Chr2:120968947..120968967 60.28 52.38
downstream ENSMUSE00000167516 Chr2:120971769..120971856 GTGCTCCTCAGCTCCAGGTA Chr2:120971836..120971855 60.56 60
downstream ENSMUSE00000684863 Chr2:120971769..120971856 GTGCTCCTCAGCTCCAGGTA Chr2:120971836..120971855 60.56 60
downstream ENSMUSE00000167522 Chr2:120973977..120974058 TATGCCTTCAAGGACGGATT Chr2:120974023..120974042 59.53 45
downstream ENSMUSE00000684861 Chr2:120973977..120974058 TATGCCTTCAAGGACGGATT Chr2:120974023..120974042 59.53 45
downstream ENSMUSE00000167518 Chr2:120975956..120976082 GTCTCCCTGGCTATTGTTGG Chr2:120976009..120976028 59.55 55
downstream ENSMUSE00000684858 Chr2:120975956..120976082 GTCTCCCTGGCTATTGTTGG Chr2:120976009..120976028 59.55 55
downstream ENSMUSE00000720552 Chr2:120975956..120976082 GTCTCCCTGGCTATTGTTGG Chr2:120976009..120976028 59.55 55
downstream ENSMUSE00000167524 Chr2:120976867..120976947 AAGATGCAATGCCAACTTCA Chr2:120976944..120976963 59.28 40
downstream ENSMUSE00000167525 Chr2:120978166..120978304 TCAGAGGCGCTAAGGAATGT Chr2:120978254..120978273 59.98 50
downstream ENSMUSE00000684857 Chr2:120980231..120980338 AGAGCTCTGCATTTGCTTCC Chr2:120980257..120980276 59.72 50
downstream ENSMUSE00000167512 Chr2:120980455..120980555 AGGGACTGTCTGGCTTTTGA Chr2:120980498..120980517 59.84 50
downstream ENSMUSE00000167523 Chr2:120981071..120982416 TTGGCTACCCAAATTCAAGG Chr2:120981376..120981395 59.93 45
downstream ENSMUSE00000561267 Chr2:120981071..120982395 TTGGCTACCCAAATTCAAGG Chr2:120981376..120981395 59.93 45
downstream ENSMUSE00000684852 Chr2:120981071..120981325 AGGACAGATCCCACACCTGA Chr2:120981173..120981192 60.53 55
downstream ENSMUSE00000684854 Chr2:120981071..120982414 TTGGCTACCCAAATTCAAGG Chr2:120981376..120981395 59.93 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTCTGGATCTCGTGGACTC Chr2:120968213..120968233 59.95 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAAGACGTGACTGGGAAAA Chr2:120968304..120968324 59.26 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027259