Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24910
Trapped Gene
Grik4 (ENSMUSG00000032017)
Vector Insertion
Chr 9: 42616721 - 42626952
Public Clones not available
Private Clones OST201328 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000700836 (Chr9:42626953..42627057 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGAGTTGTTCCCTGCTTTTC Chr9:42626973..42626992 59.85 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000700836 (Chr9:42626953..42627057 -)
Downstram Exon
ENSMUSE00000359356 (Chr9:42616576..42616720 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGAGTTGTTCCCTGCTTTTC Chr9:42626973..42626992 59.85 50 GAGACACGGGGCATCTTCTA Chr9:42616622..42616641 60.22 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000700837 Chr9:42752410..42752576 No primer for this exon
upstream ENSMUSE00000700836 Chr9:42626953..42627057 CGAGTTGTTCCCTGCTTTTC Chr9:42626973..42626992 59.85 50

*** Putative Vector Insertion (Chr 9: 42616721 - 42626952) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000359356 Chr9:42616576..42616720 GAGACACGGGGCATCTTCTA Chr9:42616622..42616641 60.22 55
downstream ENSMUSE00000700835 Chr9:42616576..42616707 GAGACACGGGGCATCTTCTA Chr9:42616622..42616641 60.22 55
downstream ENSMUSE00000413585 Chr9:42496016..42496180 TGCAGTTTCGTACTCGCTGT Chr9:42496001..42496020 59.66 50
downstream ENSMUSE00000215821 Chr9:42483296..42483393 TGTTGCTGATGATGGAGCTG Chr9:42483291..42483310 60.99 50
downstream ENSMUSE00000215820 Chr9:42479221..42479386 GGTTCAGGGTGGTGAATCTC Chr9:42479295..42479314 59.36 55
downstream ENSMUSE00000215833 Chr9:42467801..42467979 TGTCTTGTCATCCCGGATCT Chr9:42467833..42467852 60.47 50
downstream ENSMUSE00000215828 Chr9:42463570..42463623 No primer for this exon
downstream ENSMUSE00000268586 Chr9:42437060..42437221 GCATGGGATTGGTTGAAAAT Chr9:42437117..42437136 59.63 40
downstream ENSMUSE00000268562 Chr9:42431009..42431161 GTTCCTGTACCGCTGTCACC Chr9:42431082..42431101 60.58 60
downstream ENSMUSE00000215832 Chr9:42430142..42430246 AATTCAATGTGGCCGGTAAG Chr9:42430190..42430209 59.82 45
downstream ENSMUSE00000215830 Chr9:42405937..42406044 AGATGTTGGAGGCGTAGAGG Chr9:42405959..42405978 59.31 55
downstream ENSMUSE00000215819 Chr9:42399433..42399636 TGTCCACACAGAATCCCTCA Chr9:42399536..42399555 60.09 50
downstream ENSMUSE00000215824 Chr9:42374382..42374495 ACTTTCTCACGTTCCGCTGT Chr9:42374421..42374440 59.91 50
downstream ENSMUSE00000215823 Chr9:42358490..42358599 AAAGGGATCCAGGAAGGAGA Chr9:42358539..42358558 60.01 50
downstream ENSMUSE00000215826 Chr9:42355650..42355823 CTGACACAGCGGGTAGACAA Chr9:42355637..42355656 59.9 55
downstream ENSMUSE00000215818 Chr9:42351841..42352006 ACAGACTCAATGGGCACCTC Chr9:42351892..42351911 60.12 55
downstream ENSMUSE00000215817 Chr9:42349905..42350130 CACATGCGTTGGTAGGTCTG Chr9:42350077..42350096 60.17 55
downstream ENSMUSE00000215831 Chr9:42345397..42345525 CTTCCGCTTCAGAATTTCCA Chr9:42345424..42345443 60.32 45
downstream ENSMUSE00000268446 Chr9:42332563..42332681 GAACCACAAAGATTCCACCAA Chr9:42332621..42332641 59.82 42.86
downstream ENSMUSE00000400522 Chr9:42328495..42329268 ATGTTGCGCAGTTCTGTCAC Chr9:42329206..42329225 59.91 50
downstream ENSMUSE00000700834 Chr9:42326218..42329268 TAGACGCACGTAGCAACTGG Chr9:42326396..42326415 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCTCTTCCTGTGTTTTCAA Chr9:42626923..42626944 58.54 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCTCTTCCTGTGTTTTCAA Chr9:42626923..42626944 58.54 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032017