Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24933
Trapped Gene
AC117232.3 (ENSMUSG00000025362)
Vector Insertion
Chr 10: 128061693 - 128062262
Public Clones P140D08 (ggtc) P140D08 (ggtc)
Private Clones OST200633 (lexicon)
Severity of mutation (?) Insertion after 91% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000150121 (Chr10:128062263..128062393 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCCATCCATAGCAAGGTTGT Chr10:128062324..128062343 59.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000150121 (Chr10:128062263..128062393 -)
Downstram Exon
ENSMUSE00000639408 (Chr10:128061593..128061692 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCCATCCATAGCAAGGTTGT Chr10:128062324..128062343 59.96 50 CCTTCCGTCCTTACAAAACG Chr10:128061609..128061628 59.6 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000665415 Chr10:128063532..128063556 No primer for this exon
upstream ENSMUSE00000150118 Chr10:128063119..128063296 CTGAAGCAAGCGTCTTCGAC Chr10:128063120..128063139 61.26 55
upstream ENSMUSE00000150121 Chr10:128062263..128062393 GCCATCCATAGCAAGGTTGT Chr10:128062324..128062343 59.96 50

*** Putative Vector Insertion (Chr 10: 128061693 - 128062262) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639408 Chr10:128061593..128061692 CCTTCCGTCCTTACAAAACG Chr10:128061609..128061628 59.6 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTTAATCGCCTTGCAGCAC Chr10:128062194..128062214 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGAAGTCGTGACTGGGAAAA Chr10:128062197..128062218 59.32 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TTCTCAGCCTACGTGCTTCC Chr10:128062379..128062399 60.54 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTCTCAGCCTACGTGCTTCC Chr10:128062379..128062399 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025362