Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2494
Trapped Gene
Kat2b (ENSMUSG00000000708)
Vector Insertion
Chr 17: 53706904 - 53750188
Public Clones XT0324 (sanger) (sanger) (sanger) Xk351 (baygenomics) E127G05 (ggtc)
(ggtc) E064A10 (ggtc) D056E10 (ggtc) E114D10 (ggtc) (ggtc)
E063F05 (ggtc) D056E10 (ggtc) E085H10 (ggtc) (ggtc) M065B03 (ggtc)
E030H09 (ggtc) 3SE142B04 (ggtc) CMHD-GT_535C3-3 (cmhd) FHCRC-GT-S12-8H1 (fhcrc)
FHCRC-GT-S3-4C1 (fhcrc) PST19306-NR (escells) IST11222A1HMF1 (tigm) IST11526C6 (tigm)
IST10953B2 (tigm) IST10592H6 (tigm) IST12588E10 (tigm) IST11991D2 (tigm)
IST13053C6 (tigm) IST10415C7 (tigm) IST14985E10 (tigm) IST12106G3 (tigm)
IST12544C5 (tigm) IST14468D3 (tigm) IST11059C10 (tigm) IST10187B8 (tigm)
IST12092H11 (tigm) IST13050B10 (tigm) IST11295G11 (tigm) IST14165B4 (tigm)
IST12769E10 (tigm) IST11095H1 (tigm) IST10509C2 (tigm) IST11473D6 (tigm)
IST14264F7 (tigm) IST12588E10 (tigm) IST12092C6 (tigm) IST10953B2 (tigm)
IST11059C10 (tigm) IST15102C12 (tigm) IST14813A12 (tigm)
Private Clones OST452444 (lexicon) OST430837 (lexicon) OST383922 (lexicon) OST378453 (lexicon)
OST369015 (lexicon) OST339840 (lexicon) OST329239 (lexicon) OST275777 (lexicon)
OST275637 (lexicon) OST262212 (lexicon) OST260879 (lexicon) OST252274 (lexicon)
OST234980 (lexicon) OST211918 (lexicon) OST202138 (lexicon) OST192356 (lexicon)
OST191869 (lexicon) OST191440 (lexicon) OST181668 (lexicon) OST178353 (lexicon)
OST168155 (lexicon) OST148475 (lexicon) OST131529 (lexicon) OST125269 (lexicon)
OST114794 (lexicon) OST77030 (lexicon) OST76533 (lexicon) OST65974 (lexicon)
OST55998 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000657192 (Chr17:53706640..53706903 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000657192 (Chr17:53706640..53706903 +)
Downstram Exon
ENSMUSE00000321124 (Chr17:53750189..53750315 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000657192 Chr17:53706640..53706903 No primer for this exon

*** Putative Vector Insertion (Chr 17: 53706904 - 53750188) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000321124 Chr17:53750189..53750315 No primer for this exon
downstream ENSMUSE00000136510 Chr17:53763677..53763822 No primer for this exon
downstream ENSMUSE00000136498 Chr17:53768649..53768741 No primer for this exon
downstream ENSMUSE00000500961 Chr17:53771862..53772043 No primer for this exon
downstream ENSMUSE00000136503 Chr17:53777677..53777868 No primer for this exon
downstream ENSMUSE00000136509 Chr17:53780518..53780624 No primer for this exon
downstream ENSMUSE00000136495 Chr17:53783939..53784061 No primer for this exon
downstream ENSMUSE00000136490 Chr17:53788072..53788208 No primer for this exon
downstream ENSMUSE00000136507 Chr17:53792347..53792555 No primer for this exon
downstream ENSMUSE00000136497 Chr17:53793764..53793890 No primer for this exon
downstream ENSMUSE00000136502 Chr17:53798643..53798753 No primer for this exon
downstream ENSMUSE00000136493 Chr17:53799354..53799497 No primer for this exon
downstream ENSMUSE00000136489 Chr17:53802860..53802974 No primer for this exon
downstream ENSMUSE00000136500 Chr17:53804731..53804767 No primer for this exon
downstream ENSMUSE00000136505 Chr17:53804978..53805041 No primer for this exon
downstream ENSMUSE00000496895 Chr17:53805148..53805232 No primer for this exon
downstream ENSMUSE00000514532 Chr17:53810000..53812045 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTAATCGCCTTGCAGCAC Chr17:53736952..53736972 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTCGTGACTGGGAAAACC Chr17:53736951..53736971 60.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000708