Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24958
Trapped Gene
Snf1lk (ENSMUSG00000024042)
Vector Insertion
Chr 17: 31991270 - 31991838
Public Clones not available
Private Clones OST199722 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000314091 (Chr17:31991839..31992009 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGATCATGTCGGAGTTCA Chr17:31991973..31991992 59.48 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000314091 (Chr17:31991839..31992009 -)
Downstram Exon
ENSMUSE00000137475 (Chr17:31991153..31991269 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGATCATGTCGGAGTTCA Chr17:31991973..31991992 59.48 50 CCTCCCGGTAGATCTTCTCC Chr17:31991181..31991200 60.03 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000490380 Chr17:31992617..31992737 No primer for this exon
upstream ENSMUSE00000314091 Chr17:31991839..31992009 GGTGATCATGTCGGAGTTCA Chr17:31991973..31991992 59.48 50

*** Putative Vector Insertion (Chr 17: 31991270 - 31991838) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000137475 Chr17:31991153..31991269 CCTCCCGGTAGATCTTCTCC Chr17:31991181..31991200 60.03 60
downstream ENSMUSE00000547826 Chr17:31988478..31988541 TTTTTGCAAATTCTGTGACAATG Chr17:31988471..31988493 60.03 30.43
downstream ENSMUSE00000137478 Chr17:31988180..31988341 GCCCGTTGGAAGTCAGATAA Chr17:31988299..31988318 60.07 50
downstream ENSMUSE00000137474 Chr17:31987886..31988010 ACTCCTTCCCCTCGAAGACT Chr17:31987890..31987909 59.29 55
downstream ENSMUSE00000137472 Chr17:31987671..31987794 CTGTCTCAGCGTAGGCAGGT Chr17:31987695..31987714 60.61 60
downstream ENSMUSE00000137480 Chr17:31986873..31987096 CCCTAGCACCTGTTCGTTGT Chr17:31986893..31986912 60.17 55
downstream ENSMUSE00000137476 Chr17:31986464..31986619 AGGTAGTAAATGGCGGCAAA Chr17:31986551..31986570 59.61 45
downstream ENSMUSE00000137482 Chr17:31985904..31986026 AAAGGGTCACACGGGAGAAT Chr17:31985973..31985992 60.75 50
downstream ENSMUSE00000137484 Chr17:31985577..31985793 CTCGCTGATAGCTGTGTCCA Chr17:31985679..31985698 60.16 55
downstream ENSMUSE00000137487 Chr17:31984840..31985121 GAAGCTGACGGGAGGTAAGA Chr17:31984858..31984877 59.43 55
downstream ENSMUSE00000137485 Chr17:31983978..31984206 GTCCTCGCATTTTTCCTCAG Chr17:31984142..31984161 59.81 50
downstream ENSMUSE00000493746 Chr17:31981193..31983588 TACTGCTGCGGTGAGATTTG Chr17:31981941..31981960 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAATTTTGCAGTGGTTAAGCTG Chr17:31991864..31991886 59.82 40.91 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAATTTTGCAGTGGTTAAGCTG Chr17:31991864..31991886 59.82 40.91 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024042