Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24960
Trapped Gene
Bmi1 (ENSMUSG00000026739)
Vector Insertion
Chr 2: 18603551 - 18603849
Public Clones not available
Private Clones OST199633 (lexicon)
Severity of mutation (?) Insertion after 35% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000395358 (Chr2:18603420..18603550 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCATCGAACAACCAGAATCA Chr2:18603441..18603460 59.65 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000395358 (Chr2:18603420..18603550 +)
Downstram Exon
ENSMUSE00000291084 (Chr2:18603850..18603946 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCATCGAACAACCAGAATCA Chr2:18603441..18603460 59.65 45 TGGTTTTGTGAACCTGGACA Chr2:18603930..18603949 59.98 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000460324 Chr2:18598645..18599096 GAGATCGGGAGAGACAATGG Chr2:18598666..18598685 59.61 55
upstream ENSMUSE00000700109 Chr2:18601999..18602102 GTGGCATTGCTGACAGGTCT Chr2:18602014..18602033 61.29 55
upstream ENSMUSE00000395358 Chr2:18603420..18603550 GCATCGAACAACCAGAATCA Chr2:18603441..18603460 59.65 45
upstream ENSMUSE00000716920 Chr2:18603420..18603550 GCATCGAACAACCAGAATCA Chr2:18603441..18603460 59.65 45

*** Putative Vector Insertion (Chr 2: 18603551 - 18603849) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000291084 Chr2:18603850..18603946 TGGTTTTGTGAACCTGGACA Chr2:18603930..18603949 59.98 45
downstream ENSMUSE00000291074 Chr2:18604466..18604521 TTGAAAAGCCCTGGGACTAA Chr2:18604522..18604541 59.68 45
downstream ENSMUSE00000712259 Chr2:18604608..18604658 ACGGGTGAGCTGCATAAAAA Chr2:18604652..18604671 60.64 45
downstream ENSMUSE00000720202 Chr2:18604608..18604658 ACGGGTGAGCTGCATAAAAA Chr2:18604652..18604671 60.64 45
downstream ENSMUSE00000291057 Chr2:18604802..18604910 TCTCCTCGGTCTTCATTGGA Chr2:18604835..18604854 60.74 50
downstream ENSMUSE00000700106 Chr2:18604802..18604910 TCTCCTCGGTCTTCATTGGA Chr2:18604835..18604854 60.74 50
downstream ENSMUSE00000162308 Chr2:18604996..18605035 No primer for this exon
downstream ENSMUSE00000700103 Chr2:18604996..18605035 No primer for this exon
downstream ENSMUSE00000291043 Chr2:18605292..18605390 TGCTGGGCATCGTAAGTACC Chr2:18605327..18605346 61.05 55
downstream ENSMUSE00000700102 Chr2:18605292..18605390 TGCTGGGCATCGTAAGTACC Chr2:18605327..18605346 61.05 55
downstream ENSMUSE00000291036 Chr2:18605613..18605693 GGCAATGTCCATTAGCGTGT Chr2:18605675..18605694 60.92 50
downstream ENSMUSE00000700099 Chr2:18605613..18605693 GGCAATGTCCATTAGCGTGT Chr2:18605675..18605694 60.92 50
downstream ENSMUSE00000471418 Chr2:18605779..18608256 CACACGCTAAGTTCGACCAA Chr2:18607410..18607429 59.9 50
downstream ENSMUSE00000485604 Chr2:18605779..18607757 CACACGCTAAGTTCGACCAA Chr2:18607410..18607429 59.9 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGCATTTCACAGCTCATCC Chr2:18603583..18603603 59.25 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026739