Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI24975
Trapped Gene
Armet (ENSMUSG00000032575)
Vector Insertion
Chr 9: 106792634 - 106793401
Public Clones (sanger) PST22487-NR (escells)
Private Clones OST198962 (lexicon) OST35235 (lexicon)
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000508048 (Chr9:106793402..106793529 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGGACGATTTTACCAGGA Chr9:106793496..106793515 59.93 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000508048 (Chr9:106793402..106793529 -)
Downstram Exon
ENSMUSE00000220968 (Chr9:106792492..106792633 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGGACGATTTTACCAGGA Chr9:106793496..106793515 59.93 50 GGCTTCGACACCTCATTGAT Chr9:106792550..106792569 60.08 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000258780 Chr9:106794145..106794243 CTGAGGAGGATGTGGGCTAC Chr9:106794219..106794238 59.68 60
upstream ENSMUSE00000508048 Chr9:106793402..106793529 CTGGGACGATTTTACCAGGA Chr9:106793496..106793515 59.93 50

*** Putative Vector Insertion (Chr 9: 106792634 - 106793401) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000220968 Chr9:106792492..106792633 GGCTTCGACACCTCATTGAT Chr9:106792550..106792569 60.08 50
downstream ENSMUSE00000634487 Chr9:106791092..106791556 AGCAGGAATTGGGCAGACTA Chr9:106791333..106791352 59.84 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAAGTTTTGCCGTGAAGCAA Chr9:106793420..106793440 60.78 40 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGTCCGTGACTGGGAAAAC Chr9:106793335..106793355 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCATCTCCTCCCTCTTTTCC Chr9:106793530..106793550 60.01 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CCATCTCCTCCCTCTTTTCC Chr9:106793530..106793550 60.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032575