Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25000
Trapped Gene
Nfxl1 (ENSMUSG00000072889)
Vector Insertion
Chr 5: 72947585 - 72950252
Public Clones not available
Private Clones OST198495 (lexicon)
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000696394 (Chr5:72950253..72950507 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCCCTCTCAGGAAATGGAGT Chr5:72950420..72950439 60.45 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000696394 (Chr5:72950253..72950507 -)
Downstram Exon
ENSMUSE00000544227 (Chr5:72947411..72947584 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCCCTCTCAGGAAATGGAGT Chr5:72950420..72950439 60.45 55 TGCTCCTCCAACAGCTTTCT Chr5:72947487..72947506 60.13 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000696395 Chr5:72950828..72950884 GGTCCACTTCAGCAGTTGGT Chr5:72950853..72950872 60.16 55
upstream ENSMUSE00000502560 Chr5:72950253..72950838 GTTTCTGTGCCTACCGCACT Chr5:72950798..72950817 60.32 55
upstream ENSMUSE00000696394 Chr5:72950253..72950507 CCCCTCTCAGGAAATGGAGT Chr5:72950420..72950439 60.45 55

*** Putative Vector Insertion (Chr 5: 72947585 - 72950252) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000544227 Chr5:72947411..72947584 TGCTCCTCCAACAGCTTTCT Chr5:72947487..72947506 60.13 50
downstream ENSMUSE00000544226 Chr5:72943882..72943991 GCTTGGAAAGCCTCATTCAG Chr5:72943912..72943931 59.96 50
downstream ENSMUSE00000513845 Chr5:72941531..72941661 GGCTGTCTTTAGCCCACTTC Chr5:72941570..72941589 58.94 55
downstream ENSMUSE00000696389 Chr5:72932093..72932271 TACTTGGCCACACGAATGAG Chr5:72932129..72932148 59.72 50
downstream ENSMUSE00000696388 Chr5:72931731..72931892 GGGATAGGCTTGGCTTTCTT Chr5:72931804..72931823 59.69 50
downstream ENSMUSE00000696374 Chr5:72931603..72931633 AACTCTTGGACAAGGCTGACA Chr5:72931586..72931606 59.9 47.62
downstream ENSMUSE00000696387 Chr5:72931533..72931633 GGGCTTGCACAACTTCTTTC Chr5:72931530..72931549 59.86 50
downstream ENSMUSE00000696386 Chr5:72930845..72930959 TCTTCCCAGATCGAGGACAC Chr5:72930847..72930866 60.2 55
downstream ENSMUSE00000696385 Chr5:72929389..72929513 ACGCTGTGAACACCTATGGA Chr5:72929400..72929419 59.17 50
downstream ENSMUSE00000696384 Chr5:72928605..72928727 CTTTTGACAGTCCCGCATTT Chr5:72928601..72928620 60.11 45
downstream ENSMUSE00000696382 Chr5:72924284..72924374 CTATGGCAGACAGACGGACA Chr5:72924264..72924283 59.85 55
downstream ENSMUSE00000696381 Chr5:72920623..72920743 CACTTAGGTGGCCTTGTGGT Chr5:72920616..72920635 60.03 55
downstream ENSMUSE00000696380 Chr5:72920251..72920410 TGACAGCGGTGTTTTTCTTG Chr5:72920341..72920360 59.88 45
downstream ENSMUSE00000696379 Chr5:72919398..72919489 CAGGGATGGGAACTTGACAC Chr5:72919377..72919396 60.36 55
downstream ENSMUSE00000696377 Chr5:72915886..72915907 CTCATGCTTCCCCAGACATT Chr5:72915864..72915883 60.07 50
downstream ENSMUSE00000544235 Chr5:72915326..72915466 TTCTGACAGCGCAACATTCT Chr5:72915368..72915387 59.6 45
downstream ENSMUSE00000544234 Chr5:72914748..72914914 GGCTTGTGATCTTGCAGTGA Chr5:72914742..72914761 59.99 50
downstream ENSMUSE00000544233 Chr5:72913387..72913456 CTGGTTTTTGCAGCAACTGA Chr5:72913377..72913396 60.03 45
downstream ENSMUSE00000544232 Chr5:72909434..72909538 TTGCAATTAAAGGGGCATTC Chr5:72909455..72909474 59.91 40
downstream ENSMUSE00000544230 Chr5:72908265..72908351 CTTTCCGCTTCATCTCCTTG Chr5:72908251..72908270 59.95 50
downstream ENSMUSE00000544229 Chr5:72907451..72907504 GCTGCCTTCGCTTTTCTTCT Chr5:72907431..72907450 61.14 50
downstream ENSMUSE00000544228 Chr5:72904543..72905570 TCTACAGCTGCAGTCGTGCT Chr5:72905159..72905178 59.95 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCACTTCCTAATCGCCTTGC Chr5:72950189..72950209 60.35 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCACCAAACTCCCCAAGTC Chr5:72950207..72950227 63.9 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000072889