Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25010
Trapped Gene
Dus1l (ENSMUSG00000025155)
Vector Insertion
Chr 11: 120657038 - 120657456
Public Clones not available
Private Clones OST198314 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000416093 (Chr11:120657457..120657709 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCAGTCACAGACCTTCATCG Chr11:120657553..120657572 59.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000416093 (Chr11:120657457..120657709 -)
Downstram Exon
ENSMUSE00000394010 (Chr11:120656791..120657037 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCAGTCACAGACCTTCATCG Chr11:120657553..120657572 59.42 55 ACCTGGGCATGTAGCATAGG Chr11:120656848..120656867 59.98 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668736 Chr11:120657624..120657712 No primer for this exon
upstream ENSMUSE00000668739 Chr11:120657533..120657717 GCAGTCACAGACCTTCATCG Chr11:120657553..120657572 59.42 55
upstream ENSMUSE00000416093 Chr11:120657457..120657709 GCAGTCACAGACCTTCATCG Chr11:120657553..120657572 59.42 55

*** Putative Vector Insertion (Chr 11: 120657038 - 120657456) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000394010 Chr11:120656791..120657037 ACCTGGGCATGTAGCATAGG Chr11:120656848..120656867 59.98 55
downstream ENSMUSE00000356468 Chr11:120656217..120656325 AAACACCTCTGGGTCATTGG Chr11:120656277..120656296 59.82 50
downstream ENSMUSE00000309791 Chr11:120655582..120655632 CACTCCTCCTGCAGAAAAGC Chr11:120655580..120655599 60.13 55
downstream ENSMUSE00000148373 Chr11:120655148..120655260 CTGGGCGTACCTCACTGTCT Chr11:120655150..120655169 60.32 60
downstream ENSMUSE00000148376 Chr11:120654342..120654424 CCTTGATGTGTTCCCAGGAG Chr11:120654327..120654346 60.5 55
downstream ENSMUSE00000148375 Chr11:120654005..120654108 AAACACAGGGATTCCCACAG Chr11:120654062..120654081 59.82 50
downstream ENSMUSE00000148377 Chr11:120653669..120653813 GTGGTGCCACAGTTTGAAGA Chr11:120653649..120653668 59.73 50
downstream ENSMUSE00000148380 Chr11:120653341..120653441 GCCAGCTCTTCTCGAAGTTG Chr11:120653384..120653403 60.28 55
downstream ENSMUSE00000148366 Chr11:120653169..120653274 CTGGCAGATCCAATGGAAAG Chr11:120653164..120653183 60.59 50
downstream ENSMUSE00000148374 Chr11:120652519..120652664 CTCCATGCTGCCTTCTTCTT Chr11:120652567..120652586 59.57 50
downstream ENSMUSE00000148372 Chr11:120651157..120651194 TTGGATTTCCACACTGGTCA Chr11:120651137..120651156 59.94 45
downstream ENSMUSE00000148378 Chr11:120650971..120651046 TCTGAAAGCTCGCTTCTTGC Chr11:120650968..120650987 60.93 50
downstream ENSMUSE00000668735 Chr11:120650520..120650873 TAGGGCACTACCCACGACTT Chr11:120650718..120650737 59.62 55
downstream ENSMUSE00000479139 Chr11:120650516..120650873 TAGGGCACTACCCACGACTT Chr11:120650718..120650737 59.62 55
downstream ENSMUSE00000668738 Chr11:120650515..120650873 TAGGGCACTACCCACGACTT Chr11:120650718..120650737 59.62 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAAGGAGCCGTGGATAAT Chr11:120657401..120657421 60.29 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTAGGTAGGGGCAGCTCAG Chr11:120657440..120657460 58.96 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025155