Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25029
Trapped Gene
Hipk1 (ENSMUSG00000008730)
Vector Insertion
Chr 3: 103573445 - 103581144
Public Clones IST14921C12 (tigm) IST14841H4 (tigm) IST14905H7 (tigm) IST10568C2 (tigm)
IST10266E1 (tigm)
Private Clones OST197662 (lexicon)
Severity of mutation (?) Insertion after 50% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000173556 (Chr3:103581145..103582222 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000173556 (Chr3:103581145..103582222 -)
Downstram Exon
ENSMUSE00000173553 (Chr3:103573321..103573444 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000721785 Chr3:103595316..103595486 No primer for this exon
upstream ENSMUSE00000671349 Chr3:103594918..103595075 No primer for this exon
upstream ENSMUSE00000719829 Chr3:103594918..103595102 No primer for this exon
upstream ENSMUSE00000173556 Chr3:103581145..103582222 No primer for this exon
upstream ENSMUSE00000716226 Chr3:103581145..103582222 No primer for this exon

*** Putative Vector Insertion (Chr 3: 103573445 - 103581144) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000173553 Chr3:103573321..103573444 No primer for this exon
downstream ENSMUSE00000565740 Chr3:103568385..103568504 No primer for this exon
downstream ENSMUSE00000173559 Chr3:103567596..103567682 No primer for this exon
downstream ENSMUSE00000173555 Chr3:103565410..103565594 No primer for this exon
downstream ENSMUSE00000712670 Chr3:103564520..103564580 No primer for this exon
downstream ENSMUSE00000316468 Chr3:103564418..103564580 No primer for this exon
downstream ENSMUSE00000173561 Chr3:103562458..103562683 No primer for this exon
downstream ENSMUSE00000671327 Chr3:103560547..103560673 No primer for this exon
downstream ENSMUSE00000331545 Chr3:103558124..103558245 No primer for this exon
downstream ENSMUSE00000671326 Chr3:103558124..103558245 No primer for this exon
downstream ENSMUSE00000379951 Chr3:103557303..103557437 No primer for this exon
downstream ENSMUSE00000671324 Chr3:103557303..103557437 No primer for this exon
downstream ENSMUSE00000565727 Chr3:103554699..103554841 No primer for this exon
downstream ENSMUSE00000671319 Chr3:103554699..103554841 No primer for this exon
downstream ENSMUSE00000333672 Chr3:103554126..103554308 No primer for this exon
downstream ENSMUSE00000671314 Chr3:103554126..103554308 No primer for this exon
downstream ENSMUSE00000357666 Chr3:103553202..103553408 No primer for this exon
downstream ENSMUSE00000671312 Chr3:103553202..103553408 No primer for this exon
downstream ENSMUSE00000406243 Chr3:103550718..103550959 No primer for this exon
downstream ENSMUSE00000671311 Chr3:103550718..103550959 No primer for this exon
downstream ENSMUSE00000173564 Chr3:103549183..103549313 No primer for this exon
downstream ENSMUSE00000671309 Chr3:103549183..103549313 No primer for this exon
downstream ENSMUSE00000717456 Chr3:103547807..103548359 No primer for this exon
downstream ENSMUSE00000506648 Chr3:103547594..103548359 No primer for this exon
downstream ENSMUSE00000671308 Chr3:103547594..103548359 No primer for this exon
downstream ENSMUSE00000711838 Chr3:103543738..103548359 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAGTGTGCAGGTGTTCAGT Chr3:103581100..103581120 58.73 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAGTGTGCAGGTGTTCAGT Chr3:103581100..103581120 58.73 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCTTAATCGCCTTGCAGCAC Chr3:103582155..103582175 61.44 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AATTCGTGACTGGGAAAACC Chr3:103582156..103582176 58.89 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000008730