Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25034
Trapped Gene
Chd4 (ENSMUSG00000063870)
Vector Insertion
Chr 6: 125050795 - 125051012
Public Clones not available
Private Clones OST197619 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000691490 (Chr6:125050796..125051011 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTGCGCTCAGACAGTGAG Chr6:125050872..125050891 60.07 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000691490 (Chr6:125050796..125051011 +)
Downstram Exon
ENSMUSE00000496808 (Chr6:125050817..125051011 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTGCGCTCAGACAGTGAG Chr6:125050872..125050891 60.07 60 ATAGTCGCTGCCCTCACTGT Chr6:125050906..125050925 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000691506 Chr6:125045999..125046278 GGTTGGAGTTGGTTGAGGTT Chr6:125046081..125046100 58.89 50
upstream ENSMUSE00000691491 Chr6:125046180..125046278 No primer for this exon
upstream ENSMUSE00000503887 Chr6:125046181..125046278 No primer for this exon
upstream ENSMUSE00000500912 Chr6:125047105..125047283 GGACGCACTTCTGAACAACA Chr6:125047243..125047262 59.88 50
upstream ENSMUSE00000720777 Chr6:125047105..125047283 GGACGCACTTCTGAACAACA Chr6:125047243..125047262 59.88 50
upstream ENSMUSE00000497952 Chr6:125050486..125050607 AGGAAGACCCAGACGAGGAT Chr6:125050492..125050511 60.07 55

*** Putative Vector Insertion (Chr 6: 125050795 - 125051012) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000691490 Chr6:125050796..125051011 AGCTGCCGGCATAAGAGTAA Chr6:125050821..125050840 60 50
downstream ENSMUSE00000496808 Chr6:125050817..125051011 ATAGTCGCTGCCCTCACTGT Chr6:125050906..125050925 59.9 55
downstream ENSMUSE00000494719 Chr6:125051236..125051354 GCTGAAGGCCTTGTAGTTGG Chr6:125051346..125051365 59.88 55
downstream ENSMUSE00000427389 Chr6:125051471..125051712 GGGCGACTTCAGTAGCTGTC Chr6:125051658..125051677 60.02 60
downstream ENSMUSE00000427385 Chr6:125051900..125052027 CCTCCCAGCTTGATCTTCAG Chr6:125052002..125052021 59.94 55
downstream ENSMUSE00000427380 Chr6:125052181..125052316 CTTACGGCTCCGACTACTGC Chr6:125052288..125052307 60.04 60
downstream ENSMUSE00000427376 Chr6:125052450..125052628 CACCTCGCAATAGTCCTGGT Chr6:125052514..125052533 60.13 55
downstream ENSMUSE00000691502 Chr6:125052489..125052628 CACCTCGCAATAGTCCTGGT Chr6:125052514..125052533 60.13 55
downstream ENSMUSE00000427372 Chr6:125052811..125053050 CCAGAATCTCCTCACCCTCA Chr6:125052874..125052893 60.19 55
downstream ENSMUSE00000427369 Chr6:125054885..125055088 CTTTGCCCTTAAGAGCTGGA Chr6:125054909..125054928 59.59 50
downstream ENSMUSE00000519184 Chr6:125055194..125055399 GAAGCGCTCTTCCATCTCTG Chr6:125055346..125055365 60.24 55
downstream ENSMUSE00000427361 Chr6:125056427..125056558 TAGTGAACGTGGCCCTTCTT Chr6:125056456..125056475 59.73 50
downstream ENSMUSE00000427354 Chr6:125056658..125056754 CCAGTTTCCGTAGCTTCACC Chr6:125056728..125056747 59.73 55
downstream ENSMUSE00000427347 Chr6:125057486..125057677 GCTGTCGCTCATACTTCACG Chr6:125057513..125057532 59.62 55
downstream ENSMUSE00000111866 Chr6:125058299..125058499 GAACTCATTTTCCCGGATGA Chr6:125058451..125058470 59.87 45
downstream ENSMUSE00000427338 Chr6:125058677..125058814 GCAGGCCCAGTCAATAGAAC Chr6:125058772..125058791 59.7 55
downstream ENSMUSE00000427333 Chr6:125059070..125059191 GGGGTGAGAAAGTTGAGCAG Chr6:125059182..125059201 59.84 55
downstream ENSMUSE00000506771 Chr6:125059310..125059483 CTGGTCCTCTTTGGCAATGT Chr6:125059364..125059383 60.11 50
downstream ENSMUSE00000396277 Chr6:125059797..125059938 GATAAGGGTGGTTGCAGCAT Chr6:125059921..125059940 59.96 50
downstream ENSMUSE00000427320 Chr6:125060029..125060160 TAGGGCACTGCCATCATACA Chr6:125060076..125060095 60.1 50
downstream ENSMUSE00000466983 Chr6:125060271..125060388 TTCCCAGTGATTCCACCATC Chr6:125060359..125060378 60.72 50
downstream ENSMUSE00000466000 Chr6:125063483..125063607 AGCTCGAGTGGAAAGCAAGA Chr6:125063529..125063548 60.28 50
downstream ENSMUSE00000197558 Chr6:125063918..125064155 AATACGGTGGGCTCTGCTAA Chr6:125063944..125063963 59.73 50
downstream ENSMUSE00000427306 Chr6:125064309..125064484 TCTCATCCTGGTTTCGATCC Chr6:125064401..125064420 60.01 50
downstream ENSMUSE00000463872 Chr6:125070223..125070403 CGGGCTAGATCTTCTTGCTG Chr6:125070338..125070357 60.11 55
downstream ENSMUSE00000197550 Chr6:125070488..125070574 GGCCACTGAGTAATCGGACT Chr6:125070537..125070556 59.17 55
downstream ENSMUSE00000197562 Chr6:125070662..125070750 GGCCAACAGAGGAGGTAATG Chr6:125070732..125070751 59.55 55
downstream ENSMUSE00000197551 Chr6:125070858..125070991 TGCCTCGAAGATCTCTCACA Chr6:125070975..125070994 59.66 50
downstream ENSMUSE00000551277 Chr6:125071291..125071435 TCACACAAATGTCGCATGAA Chr6:125071329..125071348 59.68 40
downstream ENSMUSE00000197557 Chr6:125071534..125071699 ATGCTCCAGCGTCCATTAAC Chr6:125071574..125071593 60.1 50
downstream ENSMUSE00000197563 Chr6:125071950..125072047 GCCTCAGGGGCTGTAGATTT Chr6:125072040..125072059 60.6 55
downstream ENSMUSE00000197560 Chr6:125072141..125072300 TCACCTCTGCCTTTTCCACT Chr6:125072264..125072283 59.84 50
downstream ENSMUSE00000197556 Chr6:125072495..125072566 TACCGCAGACTTCTCCTCCA Chr6:125072538..125072557 60.93 55
downstream ENSMUSE00000197552 Chr6:125072836..125072973 GCATCACGTCCTTTTTCTCC Chr6:125072877..125072896 59.68 50
downstream ENSMUSE00000197555 Chr6:125073358..125073466 CGGTGCCAGATCTCGTAAGT Chr6:125073433..125073452 60.28 55
downstream ENSMUSE00000197565 Chr6:125073567..125073699 TACCGTGGGTCATTCTGGAT Chr6:125073614..125073633 60.19 50
downstream ENSMUSE00000483260 Chr6:125078810..125079005 CATCGACTCCTTGGACAGGT Chr6:125078971..125078990 60.11 55
downstream ENSMUSE00000399096 Chr6:125079838..125080517 TGTAACCTCACAGCGACTGG Chr6:125079940..125079959 59.9 55
downstream ENSMUSE00000691489 Chr6:125079838..125080609 TGTAACCTCACAGCGACTGG Chr6:125079940..125079959 59.9 55
downstream ENSMUSE00000691498 Chr6:125079838..125080603 TGTAACCTCACAGCGACTGG Chr6:125079940..125079959 59.9 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCCTGCTCCAGCGTTTACTC Chr6:125050786..125050806 62.22 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000063870