Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25045
Trapped Gene
Dcun1d5 (ENSMUSG00000032002)
Vector Insertion
Chr 9: 7205401 - 7206719
Public Clones not available
Private Clones OST197428 (lexicon)
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000539951 (Chr9:7205298..7205400 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000539951 (Chr9:7205298..7205400 +)
Downstram Exon
ENSMUSE00000638698 (Chr9:7206720..7207031 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GGTTTGCATTGTCTTCACGA Chr9:7206807..7206826 59.7 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000341261 Chr9:7184549..7184882 AGAGAAAAGCTCCCGGAGTG Chr9:7184813..7184832 60.89 55
upstream ENSMUSE00000215712 Chr9:7186768..7186859 AGAAAGAAGTGCCTGGCTTG Chr9:7186823..7186842 59.62 50
upstream ENSMUSE00000215711 Chr9:7188746..7188816 AAGTTGTAGGGCCAGAAGGAA Chr9:7188755..7188775 60.12 47.62
upstream ENSMUSE00000303127 Chr9:7189162..7189253 GCTGAAAGCATGGGATTTTT Chr9:7189195..7189214 59.16 40
upstream ENSMUSE00000303101 Chr9:7203263..7203371 TTTGATTTTCTGCGCTCTCA Chr9:7203294..7203313 59.69 40
upstream ENSMUSE00000303078 Chr9:7203451..7203555 TCTGCTGCTTGGGAGAACAT Chr9:7203501..7203520 60.94 50
upstream ENSMUSE00000539951 Chr9:7205298..7205400 No primer for this exon

*** Putative Vector Insertion (Chr 9: 7205401 - 7206719) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000638698 Chr9:7206720..7207031 GGTTTGCATTGTCTTCACGA Chr9:7206807..7206826 59.7 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGATGAAGACGGTGCTTGTA Chr9:7205385..7205405 59.86 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CGATGAAGACGGTGCTTGTA Chr9:7205385..7205405 59.86 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032002