Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25046
Trapped Gene
Ccdc124 (ENSMUSG00000007721)
Vector Insertion
Chr 8: 73392751 - 73392831
Public Clones not available
Private Clones OST197376 (lexicon)
Severity of mutation (?) Insertion after 51% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000224053 (Chr8:73392832..73393006 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000224053 (Chr8:73392832..73393006 -)
Downstram Exon
ENSMUSE00000213492 (Chr8:73392636..73392750 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000224065 Chr8:73397358..73397389 No primer for this exon
upstream ENSMUSE00000224057 Chr8:73393804..73393973 No primer for this exon
upstream ENSMUSE00000224053 Chr8:73392832..73393006 No primer for this exon

*** Putative Vector Insertion (Chr 8: 73392751 - 73392831) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000213492 Chr8:73392636..73392750 No primer for this exon
downstream ENSMUSE00000224042 Chr8:73392127..73392544 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CCTTAATCGCCTTGCAGCAC Chr8:73392763..73392783 63.06 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGTGCACAGATCGAGGACT Chr8:73392860..73392880 60.89 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000007721