Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25069
Trapped Gene
Ppan (ENSMUSG00000004100)
Vector Insertion
Chr 9: 20694129 - 20694214
Public Clones not available
Private Clones OST196614 (lexicon)
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000217228 (Chr9:20694078..20694128 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000217228 (Chr9:20694078..20694128 +)
Downstram Exon
ENSMUSE00000298686 (Chr9:20694215..20694385 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000298777 Chr9:20692715..20692761 No primer for this exon
upstream ENSMUSE00000298754 Chr9:20692851..20693021 No primer for this exon
upstream ENSMUSE00000217230 Chr9:20693782..20693883 No primer for this exon
upstream ENSMUSE00000217228 Chr9:20694078..20694128 No primer for this exon

*** Putative Vector Insertion (Chr 9: 20694129 - 20694214) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000298686 Chr9:20694215..20694385 No primer for this exon
downstream ENSMUSE00000298667 Chr9:20695083..20695159 No primer for this exon
downstream ENSMUSE00000217224 Chr9:20695349..20695456 No primer for this exon
downstream ENSMUSE00000217227 Chr9:20695527..20695650 No primer for this exon
downstream ENSMUSE00000217229 Chr9:20695731..20695809 No primer for this exon
downstream ENSMUSE00000217222 Chr9:20695895..20696191 No primer for this exon
downstream ENSMUSE00000298603 Chr9:20696276..20696622 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCCAGATCAGCAAGGTGAGA Chr9:20694116..20694136 59.5 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCAGATCAGCAAGGTGAGA Chr9:20694116..20694136 59.5 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000004100