Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25083
Trapped Gene
BX890623.7-201 (ENSMUSG00000078891)
Vector Insertion
Chr 2: 175596952 - 175597162
Public Clones not available
Private Clones OST195737 (lexicon) OST182194 (lexicon) OST61530 (lexicon)
Severity of mutation (?) Insertion after 56% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000678828 (Chr2:175597163..175597289 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCAGGAAGAGTGGGCTTTG Chr2:175597233..175597252 59.98 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000678828 (Chr2:175597163..175597289 -)
Downstram Exon
ENSMUSE00000678827 (Chr2:175596891..175596951 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCAGGAAGAGTGGGCTTTG Chr2:175597233..175597252 59.98 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000678825 Chr2:175605172..175605309 TGCGTGACTCTACTGGGTGT Chr2:175605211..175605230 59.34 55
upstream ENSMUSE00000678829 Chr2:175605172..175605267 TGCGTGACTCTACTGGGTGT Chr2:175605211..175605230 59.34 55
upstream ENSMUSE00000678828 Chr2:175597163..175597289 CTCAGGAAGAGTGGGCTTTG Chr2:175597233..175597252 59.98 55

*** Putative Vector Insertion (Chr 2: 175596952 - 175597162) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000678824 Chr2:175596891..175596951 No primer for this exon
downstream ENSMUSE00000678827 Chr2:175596891..175596951 No primer for this exon
downstream ENSMUSE00000678823 Chr2:175594298..175594593 TCAATGCTTGCTGCAAAGAC Chr2:175594473..175594492 60.14 45
downstream ENSMUSE00000678826 Chr2:175593640..175593679 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr2:175597091..175597111 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000078891