Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25096
Trapped Gene
A630054L15Rik (ENSMUSG00000040818)
Vector Insertion
Chr 14: 27424240 - 27425361
Public Clones E038A12 (ggtc) E038A12 (ggtc) IST10450F1 (tigm) IST10562G12 (tigm)
Private Clones OST195297 (lexicon) OST43717 (lexicon)
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000370900 (Chr14:27424160..27424239 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCTGCCTATCATGGGACT Chr14:27424210..27424229 59.95 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000370900 (Chr14:27424160..27424239 +)
Downstram Exon
ENSMUSE00000398486 (Chr14:27425362..27425424 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCTGCCTATCATGGGACT Chr14:27424210..27424229 59.95 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000406003 Chr14:27399064..27399348 GCTACACTGCGTGTGTGTGG Chr14:27399294..27399313 61.44 60
upstream ENSMUSE00000355312 Chr14:27411719..27411757 No primer for this exon
upstream ENSMUSE00000398626 Chr14:27411881..27411923 No primer for this exon
upstream ENSMUSE00000251520 Chr14:27419102..27419214 TCTGGGAGAAGGGTGTCACT Chr14:27419146..27419165 59.68 55
upstream ENSMUSE00000251514 Chr14:27419930..27420010 No primer for this exon
upstream ENSMUSE00000251572 Chr14:27422534..27422639 No primer for this exon
upstream ENSMUSE00000370900 Chr14:27424160..27424239 CACCTGCCTATCATGGGACT Chr14:27424210..27424229 59.95 55

*** Putative Vector Insertion (Chr 14: 27424240 - 27425361) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000398486 Chr14:27425362..27425424 No primer for this exon
downstream ENSMUSE00000353400 Chr14:27426391..27426446 CCACCTCGTGAACAGTAGGC Chr14:27426439..27426458 60.71 60
downstream ENSMUSE00000251504 Chr14:27427576..27427698 CCCAGAGCATCTGACTGTGA Chr14:27427619..27427638 59.98 55
downstream ENSMUSE00000251540 Chr14:27428022..27428117 ATCGTGAAGTAAGGCCGAAA Chr14:27428075..27428094 59.71 45
downstream ENSMUSE00000251495 Chr14:27431453..27431547 CGAATAATGTGTGGCCAGTG Chr14:27431527..27431546 59.99 50
downstream ENSMUSE00000251438 Chr14:27436077..27436142 No primer for this exon
downstream ENSMUSE00000251479 Chr14:27436380..27436444 No primer for this exon
downstream ENSMUSE00000251474 Chr14:27438801..27438890 TAGCGCCGGAGAATAACACT Chr14:27438856..27438875 59.87 50
downstream ENSMUSE00000251469 Chr14:27446192..27446245 CTTTTCTGCAAAGGCATCAAG Chr14:27446231..27446251 60 42.86
downstream ENSMUSE00000251463 Chr14:27446351..27446460 CAGTCGCCCTTTATTCCAGA Chr14:27446448..27446467 60.21 50
downstream ENSMUSE00000251455 Chr14:27446805..27446907 TCTTGAACCAGCCATCAAAA Chr14:27446848..27446867 59.25 40
downstream ENSMUSE00000251448 Chr14:27448158..27448232 CAGCTTCAACACAAGGTCCA Chr14:27448223..27448242 59.87 50
downstream ENSMUSE00000434196 Chr14:27448914..27452880 GGCCTCAGCACTGAACTAGG Chr14:27451413..27451432 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCTGCCTATCATGGGACTA Chr14:27424211..27424232 59.96 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCTGCCTATCATGGGACTA Chr14:27424211..27424232 59.96 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040818