Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25099
Trapped Gene
Slc38a5 (ENSMUSG00000031170)
Vector Insertion
Chr X: 7849236 - 7849777
Public Clones not available
Private Clones OST195170 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000207046 (ChrX:7849157..7849235 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACCCGTAACCCTGCTACTG ChrX:7849190..7849209 60.56 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000207046 (ChrX:7849157..7849235 +)
Downstram Exon
ENSMUSE00000207040 (ChrX:7849778..7849893 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACCCGTAACCCTGCTACTG ChrX:7849190..7849209 60.56 60 TGATAGCGTTGCTGAGGTTG ChrX:7849835..7849854 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000703512 ChrX:7848277..7848386 ATTCGCATACCGGTCAGTTC ChrX:7848296..7848315 59.96 50
upstream ENSMUSE00000398136 ChrX:7848520..7848631 AGACAGAGTCTGCCCTGTGG ChrX:7848563..7848582 60.46 60
upstream ENSMUSE00000703509 ChrX:7848768..7849069 TACCCCATCTCTTTGCCAAC ChrX:7848991..7849010 59.93 50
upstream ENSMUSE00000367863 ChrX:7849013..7849069 ATGAATGGAACCCTCTCTGC ChrX:7849035..7849054 59.09 50
upstream ENSMUSE00000703511 ChrX:7849013..7849069 ATGAATGGAACCCTCTCTGC ChrX:7849035..7849054 59.09 50
upstream ENSMUSE00000207046 ChrX:7849157..7849235 CACCCGTAACCCTGCTACTG ChrX:7849190..7849209 60.56 60

*** Putative Vector Insertion (Chr X: 7849236 - 7849777) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000207040 ChrX:7849778..7849893 TGATAGCGTTGCTGAGGTTG ChrX:7849835..7849854 60.01 50
downstream ENSMUSE00000207042 ChrX:7850001..7850074 CAGGTCAGCAGGAGGTGAAT ChrX:7850063..7850082 60.26 55
downstream ENSMUSE00000207050 ChrX:7850713..7850805 CCAACGTTGTGCAGACAGAT ChrX:7850806..7850825 59.75 50
downstream ENSMUSE00000207044 ChrX:7850924..7851002 GGAAGGTGCCAATAACAAGG ChrX:7850986..7851005 59.43 50
downstream ENSMUSE00000207045 ChrX:7853246..7853328 TTCCCCTTCAAGAACCAGTC ChrX:7853269..7853288 59.11 50
downstream ENSMUSE00000207049 ChrX:7853705..7853763 GCTTGTGTACCCCAGGTAGC ChrX:7853727..7853746 59.62 60
downstream ENSMUSE00000207048 ChrX:7853866..7853994 GTTAAACGCCTGCAAAGGAG ChrX:7853958..7853977 59.88 50
downstream ENSMUSE00000207051 ChrX:7854147..7854226 GTAGATGGGCAGCACCTCAG ChrX:7854215..7854234 60.82 60
downstream ENSMUSE00000207053 ChrX:7854819..7854919 GGTCGCTGTGAGTCCATACA ChrX:7854900..7854919 59.71 55
downstream ENSMUSE00000207041 ChrX:7855155..7855270 CCAGACGCACACAAAGGATA ChrX:7855226..7855245 59.72 50
downstream ENSMUSE00000207054 ChrX:7855984..7856128 CAAAGATATCGCGGATGGTT ChrX:7856122..7856141 59.92 45
downstream ENSMUSE00000207047 ChrX:7856219..7856322 ATGAGGCTAGGGGCTGAAGT ChrX:7856246..7856265 60.23 55
downstream ENSMUSE00000336473 ChrX:7856878..7857300 AGGCAACTCTAAGGGGAAGG ChrX:7857168..7857187 59.71 55
downstream ENSMUSE00000703510 ChrX:7856878..7857305 AGGCAACTCTAAGGGGAAGG ChrX:7857168..7857187 59.71 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CACCCGTAACCCTGCTACTG ChrX:7849191..7849211 60.56 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACCCGTAACCCTGCTACTG ChrX:7849191..7849211 60.56 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031170