Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI251
Trapped Gene
Ankle2 (ENSMUSG00000029501)
Vector Insertion
Chr 5: 110682934 - 110683319
Public Clones GC0401 (tigem)
Private Clones not available
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000189578 (Chr5:110682802..110682933 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTGGTCTGTACCCAGCAAT Chr5:110682863..110682882 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000189578 (Chr5:110682802..110682933 +)
Downstram Exon
ENSMUSE00000298834 (Chr5:110683320..110685666 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTGGTCTGTACCCAGCAAT Chr5:110682863..110682882 59.99 55 GATGGCTCGGGTAAAACTCA Chr5:110685445..110685464 60.07 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000444655 Chr5:110660060..110660442 No primer for this exon
upstream ENSMUSE00000444642 Chr5:110663366..110663839 CTGTGGACGGGAAACAAACT Chr5:110663609..110663628 60.01 50
upstream ENSMUSE00000444634 Chr5:110665292..110665498 TGTCTCCTGTGAAGGCAGTG Chr5:110665451..110665470 60.02 55
upstream ENSMUSE00000540519 Chr5:110666674..110666870 TTACAAAAACCCCCGTACCC Chr5:110666729..110666748 60.8 50
upstream ENSMUSE00000298893 Chr5:110666966..110667154 AGCGCATCCTCTACGTTGTT Chr5:110667105..110667124 59.9 50
upstream ENSMUSE00000189570 Chr5:110670948..110671070 GGCTTTGATACACCACTGCAT Chr5:110670948..110670968 60.01 47.62
upstream ENSMUSE00000189574 Chr5:110673523..110673589 GCCAAAACAAATCTCCAGCA Chr5:110673539..110673558 61.15 45
upstream ENSMUSE00000189571 Chr5:110678350..110678519 ACTGTAGAAGCAGCCCCAGA Chr5:110678449..110678468 60.01 55
upstream ENSMUSE00000189576 Chr5:110679720..110679826 CTCCACCTCGAAAGAAAGCA Chr5:110679748..110679767 60.51 50
upstream ENSMUSE00000189577 Chr5:110680516..110680706 CTGCCTTCAGGACAGAACCT Chr5:110680678..110680697 59.45 55
upstream ENSMUSE00000298853 Chr5:110681731..110682361 CAGAGTCAGCCCACAACTGA Chr5:110681838..110681857 60.02 55
upstream ENSMUSE00000540517 Chr5:110681731..110681816 TCTCCGTGGGAGCATTTCTA Chr5:110681758..110681777 60.73 50
upstream ENSMUSE00000540514 Chr5:110682051..110682361 GGATGAGGTGCTTCCTTCAA Chr5:110682131..110682150 60.19 50
upstream ENSMUSE00000189578 Chr5:110682802..110682933 CCTGGTCTGTACCCAGCAAT Chr5:110682863..110682882 59.99 55

*** Putative Vector Insertion (Chr 5: 110682934 - 110683319) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000298834 Chr5:110683320..110685666 GATGGCTCGGGTAAAACTCA Chr5:110685445..110685464 60.07 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCAGAGACTGACAGGGTTG Chr5:110682959..110682979 60.02 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCAGAGACTGACAGGGTTG Chr5:110682959..110682979 60.02 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000029501