Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25101
Trapped Gene
5730409G15Rik (ENSMUSG00000022544)
Vector Insertion
Chr 16: 5249542 - 5250567
Public Clones not available
Private Clones OST195145 (lexicon)
Severity of mutation (?) Insertion after 24% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000491686 (Chr16:5250568..5250648 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCACGGACCTTCTGTGAAGT Chr16:5250603..5250622 60.31 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000491686 (Chr16:5250568..5250648 -)
Downstram Exon
ENSMUSE00000487712 (Chr16:5249440..5249541 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCACGGACCTTCTGTGAAGT Chr16:5250603..5250622 60.31 55 GCCTCATACAGTGCATCCAA Chr16:5249476..5249495 59.68 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000480632 Chr16:5255934..5256049 No primer for this exon
upstream ENSMUSE00000498402 Chr16:5253118..5253180 TTCTGAGCTGTTGCTGGCTA Chr16:5253129..5253148 59.89 50
upstream ENSMUSE00000491686 Chr16:5250568..5250648 GCACGGACCTTCTGTGAAGT Chr16:5250603..5250622 60.31 55

*** Putative Vector Insertion (Chr 16: 5249542 - 5250567) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000487712 Chr16:5249440..5249541 GCCTCATACAGTGCATCCAA Chr16:5249476..5249495 59.68 50
downstream ENSMUSE00000128138 Chr16:5249005..5249138 TAGAGAGCAGCGTCCCATGT Chr16:5249028..5249047 60.97 55
downstream ENSMUSE00000128140 Chr16:5248658..5248923 TAAGGAGAAGCCGTTGAGGA Chr16:5248754..5248773 59.95 50
downstream ENSMUSE00000128136 Chr16:5247546..5247692 GGACCCTGACCAGTGACAGT Chr16:5247626..5247645 60.01 60
downstream ENSMUSE00000450304 Chr16:5244248..5245478 TCGCTCACTCACAGATGACC Chr16:5244630..5244649 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGGCCACATAGTGGGGTA Chr16:5250519..5250539 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGGCCACATAGTGGGGTA Chr16:5250519..5250539 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022544