Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25103
Trapped Gene
Pcyt1b (ENSMUSG00000035246)
Vector Insertion
Chr X: 90952014 - 90963123
Public Clones IST14421H8 (tigm)
Private Clones OST195142 (lexicon) OST193803 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000301058 (ChrX:90951897..90952013 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGGCACTTATGCAAGCAA ChrX:90951958..90951977 60.77 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000301058 (ChrX:90951897..90952013 +)
Downstram Exon
ENSMUSE00000301051 (ChrX:90963124..90963275 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGGCACTTATGCAAGCAA ChrX:90951958..90951977 60.77 45 TCTGCCTCGTTCATCACAGT ChrX:90963184..90963203 59.42 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000697499 ChrX:90900202..90900555 TCAGCACTGGGCATATCAAG ChrX:90900361..90900380 59.82 50
upstream ENSMUSE00000379410 ChrX:90920451..90920815 GGGTGGGGGTAACCTCTTTA ChrX:90920539..90920558 60.05 55
upstream ENSMUSE00000301065 ChrX:90947424..90947523 CATGAAAAACTGACCGTTGC ChrX:90947481..90947500 59.17 45
upstream ENSMUSE00000301058 ChrX:90951897..90952013 AAGGGCACTTATGCAAGCAA ChrX:90951958..90951977 60.77 45

*** Putative Vector Insertion (Chr X: 90952014 - 90963123) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000301051 ChrX:90963124..90963275 TCTGCCTCGTTCATCACAGT ChrX:90963184..90963203 59.42 50
downstream ENSMUSE00000301043 ChrX:90965518..90965596 TCATCGTGAGCCACAAAGTC ChrX:90965543..90965562 59.84 50
downstream ENSMUSE00000550255 ChrX:90977016..90977158 CACGGACAATTCTGGTGATG ChrX:90977087..90977106 59.96 50
downstream ENSMUSE00000301027 ChrX:90980104..90980292 TCTTGTCCACCTGGTTCTGG ChrX:90980143..90980162 61.1 55
downstream ENSMUSE00000348646 ChrX:90991558..90995287 GTGTGTAGGGCCTGCAAAAT ChrX:90993893..90993912 60 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTTTGTGTCGGTGGGTTAAT ChrX:90958048..90958069 60.14 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AATATGCTTCCTGCGTGACTG ChrX:90958052..90958073 60.28 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000035246