Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25132
Trapped Gene
1810009A15Rik (ENSMUSG00000071653)
Vector Insertion
Chr 19: 8963455 - 8963613
Public Clones not available
Private Clones OST194291 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000621633 (Chr19:8963410..8963454 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCGGGAGGAAAGATCAAT Chr19:8963423..8963442 60.4 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000621633 (Chr19:8963410..8963454 +)
Downstram Exon
ENSMUSE00000621632 (Chr19:8963614..8963738 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCGGGAGGAAAGATCAAT Chr19:8963423..8963442 60.4 50 GCTTCTTGAGGTGGTGCTTC Chr19:8963737..8963756 60 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000621633 Chr19:8963410..8963454 CTCCGGGAGGAAAGATCAAT Chr19:8963423..8963442 60.4 50

*** Putative Vector Insertion (Chr 19: 8963455 - 8963613) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000621632 Chr19:8963614..8963738 GCTTCTTGAGGTGGTGCTTC Chr19:8963737..8963756 60 55
downstream ENSMUSE00000621631 Chr19:8964493..8964590 CAAGAGTTTCCTGCGCTTCT Chr19:8964550..8964569 59.76 50
downstream ENSMUSE00000621630 Chr19:8964901..8965230 CAGGGTCCGCTGTAGAAGAG Chr19:8965130..8965149 60.01 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACTGTGGGAGTGGGAACTG Chr19:8963463..8963483 60 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACTGTGGGAGTGGGAACTG Chr19:8963463..8963483 60 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000071653