Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25146
Trapped Gene
4933430I17Rik (ENSMUSG00000058046)
Vector Insertion
Chr 4: 62186913 - 62193285
Public Clones IST14775E4 (tigm)
Private Clones OST193952 (lexicon)
Severity of mutation (?) Insertion after 4% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000377325 (Chr4:62186816..62186912 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTTCGGAGCTCAATTTGGTC Chr4:62186858..62186877 59.81 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000377325 (Chr4:62186816..62186912 +)
Downstram Exon
ENSMUSE00000331232 (Chr4:62193286..62193438 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTTCGGAGCTCAATTTGGTC Chr4:62186858..62186877 59.81 50 CAAGGTACAAACGGCTTCGT Chr4:62193338..62193357 60.17 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000451546 Chr4:62186403..62186430 CTGGTGCCTAGCTTGGAAAG Chr4:62186410..62186429 60.01 55
upstream ENSMUSE00000377325 Chr4:62186816..62186912 CTTCGGAGCTCAATTTGGTC Chr4:62186858..62186877 59.81 50

*** Putative Vector Insertion (Chr 4: 62186913 - 62193285) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000331232 Chr4:62193286..62193438 CAAGGTACAAACGGCTTCGT Chr4:62193338..62193357 60.17 50
downstream ENSMUSE00000340382 Chr4:62193550..62193694 CTTCGACAATGAGGGACGAT Chr4:62193674..62193693 60.07 50
downstream ENSMUSE00000378380 Chr4:62197545..62197602 GGCCTAGGAGAACGGCTAGT Chr4:62197598..62197617 59.87 60
downstream ENSMUSE00000342914 Chr4:62199897..62199997 AACCCAGGTCACAACCATGT Chr4:62199974..62199993 60.13 50
downstream ENSMUSE00000380599 Chr4:62201453..62201516 GCCAGCTGGAAACATCAGTC Chr4:62201487..62201506 60.81 55
downstream ENSMUSE00000345095 Chr4:62202837..62203000 ATTGCTCCAAGTGGTGTTCTG Chr4:62202935..62202955 60.16 47.62
downstream ENSMUSE00000382810 Chr4:62203670..62203817 ACTTTCAGGTCGCCTCCTTT Chr4:62203772..62203791 60.25 50
downstream ENSMUSE00000348670 Chr4:62204162..62204249 AGGATACCGCAGTGATGGTC Chr4:62204185..62204204 59.96 55
downstream ENSMUSE00000383681 Chr4:62204489..62204535 GAGGAAAGGTTTTCGCCTTC Chr4:62204530..62204549 60.19 50
downstream ENSMUSE00000350735 Chr4:62204731..62204773 TGGCCCTTGACATTTCTCTT Chr4:62204771..62204790 59.67 45
downstream ENSMUSE00000413177 Chr4:62207054..62207175 GGCGTTTGTTGATCTTCCTG Chr4:62207135..62207154 60.64 50
downstream ENSMUSE00000336099 Chr4:62208299..62208362 TCCGGAGTGGCGTAGTATTC Chr4:62208363..62208382 60.1 55
downstream ENSMUSE00000374137 Chr4:62208567..62209027 GGTTACGGTCTTTGCTGGAA Chr4:62208659..62208678 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGCATGGCAATTTAGAAGG Chr4:62189931..62189951 60.96 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGCATGGCAATTTAGAAGG Chr4:62189931..62189951 60.96 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000058046