Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25148
Trapped Gene
AC154532.3-202 (ENSMUSG00000056234)
Vector Insertion
Chr 14: 32984089 - 32985488
Public Clones not available
Private Clones OST193935 (lexicon)
Severity of mutation (?) Insertion after 8% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000343400 (Chr14:32983934..32984088 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGAGTACTTCGGGCTGAACA Chr14:32984044..32984063 60.26 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000343400 (Chr14:32983934..32984088 +)
Downstram Exon
ENSMUSE00000121903 (Chr14:32985489..32985629 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGAGTACTTCGGGCTGAACA Chr14:32984044..32984063 60.26 55 CATTCCAGGTGGCGACTTAT Chr14:32985535..32985554 59.96 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690094 Chr14:32973169..32973196 No primer for this exon
upstream ENSMUSE00000343400 Chr14:32983934..32984088 GGAGTACTTCGGGCTGAACA Chr14:32984044..32984063 60.26 55

*** Putative Vector Insertion (Chr 14: 32984089 - 32985488) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000121903 Chr14:32985489..32985629 CATTCCAGGTGGCGACTTAT Chr14:32985535..32985554 59.96 50
downstream ENSMUSE00000121900 Chr14:32985793..32985881 No primer for this exon
downstream ENSMUSE00000121906 Chr14:32986075..32986183 AAGGGATCCAAATGTGGTGA Chr14:32986177..32986196 60.17 45
downstream ENSMUSE00000121904 Chr14:32986587..32986676 CCATCAGATGCTCAGGGATT Chr14:32986611..32986630 60.03 50
downstream ENSMUSE00000486461 Chr14:32987576..32987719 CTGAAGACCAATGGCAGGTT Chr14:32987653..32987672 60.11 50
downstream ENSMUSE00000121901 Chr14:32989125..32990141 GGCCTCCAAGTGGTCATTTA Chr14:32989568..32989587 59.93 50
downstream ENSMUSE00000484533 Chr14:32990419..32990559 GCTGCATACAGGCAAAGAGA Chr14:32990518..32990537 59.18 50
downstream ENSMUSE00000690091 Chr14:32991009..32992438 GTGTACCGGGATGTGGTTTC Chr14:32991287..32991306 60.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCTGGCTTTAGCACAAGG Chr14:32984116..32984136 59.88 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGTCTGGCTTTAGCACAAGG Chr14:32984116..32984136 59.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056234