Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25157
Trapped Gene
Plekhf1 (ENSMUSG00000074170)
Vector Insertion
Chr 7: 39007178 - 39012959
Public Clones not available
Private Clones OST193594 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000635236 (Chr7:39012960..39013010 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000635236 (Chr7:39012960..39013010 -)
Downstram Exon
ENSMUSE00000635235 (Chr7:39005694..39007177 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GTCCTCATCGGAGTCATCGT Chr7:39006384..39006403 60.08 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000635236 Chr7:39012960..39013010 No primer for this exon

*** Putative Vector Insertion (Chr 7: 39007178 - 39012959) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000635235 Chr7:39005694..39007177 GTCCTCATCGGAGTCATCGT Chr7:39006384..39006403 60.08 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGCAGCCTCACATTACAG Chr7:39012967..39012987 59.47 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGGCAGCCTCACATTACAG Chr7:39012967..39012987 59.47 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074170