Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25172
Trapped Gene
Cd97 (ENSMUSG00000002885)
Vector Insertion
Chr 8: 86257466 - 86257907
Public Clones not available
Private Clones OST193046 (lexicon)
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000212250 (Chr8:86257908..86258024 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000212250 (Chr8:86257908..86258024 -)
Downstram Exon
ENSMUSE00000212248 (Chr8:86257313..86257465 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000581482 Chr8:86265006..86265068 No primer for this exon
upstream ENSMUSE00000212241 Chr8:86258195..86258251 No primer for this exon
upstream ENSMUSE00000212250 Chr8:86257908..86258024 No primer for this exon

*** Putative Vector Insertion (Chr 8: 86257466 - 86257907) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000212248 Chr8:86257313..86257465 No primer for this exon
downstream ENSMUSE00000212237 Chr8:86255802..86255936 No primer for this exon
downstream ENSMUSE00000212245 Chr8:86254010..86254156 No primer for this exon
downstream ENSMUSE00000212240 Chr8:86253281..86253424 No primer for this exon
downstream ENSMUSE00000212233 Chr8:86253156..86253202 No primer for this exon
downstream ENSMUSE00000212243 Chr8:86252956..86253033 No primer for this exon
downstream ENSMUSE00000212251 Chr8:86252180..86252339 No primer for this exon
downstream ENSMUSE00000212236 Chr8:86251994..86252110 No primer for this exon
downstream ENSMUSE00000212235 Chr8:86251644..86251867 No primer for this exon
downstream ENSMUSE00000212246 Chr8:86249764..86249928 No primer for this exon
downstream ENSMUSE00000212249 Chr8:86249054..86249245 No primer for this exon
downstream ENSMUSE00000212234 Chr8:86248668..86248897 No primer for this exon
downstream ENSMUSE00000212239 Chr8:86248517..86248586 No primer for this exon
downstream ENSMUSE00000212247 Chr8:86248337..86248428 No primer for this exon
downstream ENSMUSE00000212244 Chr8:86248091..86248259 No primer for this exon
downstream ENSMUSE00000212242 Chr8:86247878..86247976 No primer for this exon
downstream ENSMUSE00000681668 Chr8:86247271..86247801 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCAGCTCGGAGAAGGAATTG Chr8:86257934..86257954 60.47 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGGTTTGGACTCCGTGACTG Chr8:86257848..86257868 60.15 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002885