Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25181
Trapped Gene
Ilk (ENSMUSG00000030890)
Vector Insertion
Chr 7: 112885231 - 112885614
Public Clones not available
Private Clones OST192683 (lexicon) OST185987 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000391663 (Chr7:112885183..112885230 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000391663 (Chr7:112885183..112885230 +)
Downstram Exon
ENSMUSE00000345829 (Chr7:112885615..112885751 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CTGTGTTGTCCAGCCACAAG Chr7:112885735..112885754 60.35 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000391663 Chr7:112885183..112885230 No primer for this exon

*** Putative Vector Insertion (Chr 7: 112885231 - 112885614) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000345829 Chr7:112885615..112885751 CTGTGTTGTCCAGCCACAAG Chr7:112885735..112885754 60.35 55
downstream ENSMUSE00000204683 Chr7:112888691..112888856 ATCCCCACGATTCATCACAT Chr7:112888805..112888824 60.02 45
downstream ENSMUSE00000204687 Chr7:112889027..112889122 CTGCATTGATGTCAGCCTTG Chr7:112889060..112889079 60.41 50
downstream ENSMUSE00000204681 Chr7:112889285..112889381 GTCCACAGGCATCTCTCCAT Chr7:112889350..112889369 60.08 55
downstream ENSMUSE00000204686 Chr7:112889474..112889557 TGAGATTCTGGCCCATTTTC Chr7:112889506..112889525 60.01 45
downstream ENSMUSE00000204679 Chr7:112889662..112889747 TCTCATTGAGCTTTGCCAGA Chr7:112889736..112889755 59.67 45
downstream ENSMUSE00000204690 Chr7:112889888..112889997 TCTCGAACCTTCAGCACCTT Chr7:112889949..112889968 59.99 50
downstream ENSMUSE00000204691 Chr7:112890094..112890221 CCAGTGTGTGATGAGGGTTG Chr7:112890181..112890200 60 55
downstream ENSMUSE00000204685 Chr7:112890301..112890422 ACTGCGGCTATTGAGTGCAT Chr7:112890419..112890438 60.83 50
downstream ENSMUSE00000204677 Chr7:112890511..112890610 TTCGGGCAGTCATATCTTCA Chr7:112890538..112890557 59.23 45
downstream ENSMUSE00000204694 Chr7:112890721..112890851 ACATGTCTGCTGAGCGTCTG Chr7:112890771..112890790 60.21 55
downstream ENSMUSE00000632980 Chr7:112891027..112891432 GCAGGGAACAAGTCCCATAA Chr7:112891317..112891336 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGTCTTGCAAACCCGTTAAT Chr7:112885265..112885286 59.14 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTGCAAACCCGTCGTGACT Chr7:112885269..112885289 63.52 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030890