Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25200
Trapped Gene
Cib2 (ENSMUSG00000037493)
Vector Insertion
Chr 9: 54393892 - 54396139
Public Clones not available
Private Clones OST191939 (lexicon)
Severity of mutation (?) Insertion after 62% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000269256 (Chr9:54396140..54396287 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCTGTGCTCTGCGAATCAG Chr9:54396182..54396201 59.88 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000269256 (Chr9:54396140..54396287 -)
Downstram Exon
ENSMUSE00000269240 (Chr9:54393696..54393891 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCTGTGCTCTGCGAATCAG Chr9:54396182..54396201 59.88 55 TCCAGGTCAGCCTCTTCAAT Chr9:54393740..54393759 59.8 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636858 Chr9:54407775..54407994 GGGAACAAGCAGACCATCTT Chr9:54407803..54407822 59.14 50
upstream ENSMUSE00000269312 Chr9:54402294..54402328 No primer for this exon
upstream ENSMUSE00000269279 Chr9:54397588..54397699 GTCCCGATGGACTACAGGAA Chr9:54397643..54397662 59.93 55
upstream ENSMUSE00000269256 Chr9:54396140..54396287 CTCTGTGCTCTGCGAATCAG Chr9:54396182..54396201 59.88 55

*** Putative Vector Insertion (Chr 9: 54393892 - 54396139) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000269240 Chr9:54393696..54393891 TCCAGGTCAGCCTCTTCAAT Chr9:54393740..54393759 59.8 50
downstream ENSMUSE00000699035 Chr9:54392603..54393291 TGGCAGTGTCTTCAGATTCG Chr9:54393237..54393256 59.98 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAACTGCATTGCTGGAAGG Chr9:54396094..54396114 60.4 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAACTGCATTGCTGGAAGG Chr9:54396094..54396114 60.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037493