Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2521
Trapped Gene
Ppard (ENSMUSG00000002250)
Vector Insertion
Chr 17: 28423413 - 28432285
Public Clones XS0888 (sanger) XS0418 (sanger) XG364 (baygenomics) CSJ215 (baygenomics)
CSI804 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 10% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000363935 (Chr17:28423206..28423412 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000363935 (Chr17:28423206..28423412 +)
Downstram Exon
ENSMUSE00000139880 (Chr17:28432286..28432440 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000479953 Chr17:28369699..28369809 No primer for this exon
upstream ENSMUSE00000426192 Chr17:28373957..28374040 No primer for this exon
upstream ENSMUSE00000363935 Chr17:28423206..28423412 No primer for this exon

*** Putative Vector Insertion (Chr 17: 28423413 - 28432285) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139880 Chr17:28432286..28432440 No primer for this exon
downstream ENSMUSE00000242645 Chr17:28434031..28434169 No primer for this exon
downstream ENSMUSE00000242620 Chr17:28435222..28435424 No primer for this exon
downstream ENSMUSE00000139889 Chr17:28435529..28435979 No primer for this exon
downstream ENSMUSE00000242569 Chr17:28436547..28438410 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGCCATTACGGAAATGACTG Chr17:28423437..28423457 60.33 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAACGTGACTGGGAAAACC Chr17:28423460..28423480 59.87 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000002250