Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2523
Trapped Gene
1500012F01Rik (ENSMUSG00000074578)
Vector Insertion
Chr 2: 166889228 - 166890658
Public Clones AQ0027 (sanger) AP0614 (sanger) XR1020 (sanger) XS0877 (sanger)
AS0182 (sanger) XP0198 (sanger) AN0491 (sanger) CD0025 (sanger)
AQ0043 (sanger) AC0514 (sanger) AN0488 (sanger) XH621 (baygenomics)
IST14167G4 (tigm)
Private Clones OST452774 (lexicon) OST350248 (lexicon) OST284983 (lexicon) OST250183 (lexicon)
OST176922 (lexicon) OST175317 (lexicon) OST153793 (lexicon) OST105260 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639035 (Chr2:166889136..166889227 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GCATCGAGGGAGATGAGAAC Chr2:166889183..166889202 59.77 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639035 (Chr2:166889136..166889227 +)
Downstram Exon
ENSMUSE00000639034 (Chr2:166890659..166890717 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GCATCGAGGGAGATGAGAAC Chr2:166889183..166889202 59.77 55 GTTCACGCTCCATTCAAAGC Chr2:166890703..166890722 60.79 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639036 Chr2:166888722..166888797 GGCTCCTAGAGCGTTTGCTT Chr2:166888735..166888754 61.03 55
upstream ENSMUSE00000639035 Chr2:166889136..166889227 GCATCGAGGGAGATGAGAAC Chr2:166889183..166889202 59.77 55

*** Putative Vector Insertion (Chr 2: 166889228 - 166890658) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639034 Chr2:166890659..166890717 GTTCACGCTCCATTCAAAGC Chr2:166890703..166890722 60.79 50
downstream ENSMUSE00000639033 Chr2:166890934..166890980 AGATCAGACCAACACCTGCAT Chr2:166890973..166890993 59.59 47.62
downstream ENSMUSE00000639032 Chr2:166891187..166891355 CACTACTCCCCAGCCAAAAA Chr2:166891289..166891308 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCAATCACGTGCTTTGAAGA Chr2:166889257..166889277 59.99 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCAATCACGTGCTTTGAAGA Chr2:166889257..166889277 59.99 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074578