Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25237
Trapped Gene
Son (ENSMUSG00000022961)
Vector Insertion
Chr 16: 91654855 - 91656949
Public Clones not available
Private Clones OST190795 (lexicon) OST65680 (lexicon)
Severity of mutation (?) Insertion after 18% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000697861 (Chr16:91654856..91660825 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCGGAGTAAGCGTTCCAAG Chr16:91660157..91660176 60.01 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000697861 (Chr16:91654856..91660825 +)
Downstram Exon
ENSMUSE00000248612 (Chr16:91654856..91656948 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCGGAGTAAGCGTTCCAAG Chr16:91660157..91660176 60.01 55 ATTGTTACAACGGGCTCAGG Chr16:91655402..91655421 59.99 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000718814 Chr16:91647751..91648229 TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50
upstream ENSMUSE00000248625 Chr16:91648069..91648229 TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50
upstream ENSMUSE00000709905 Chr16:91648124..91648229 TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50
upstream ENSMUSE00000715014 Chr16:91648130..91648229 TCCGGGAAATACAACAGGAG Chr16:91648202..91648221 59.93 50
upstream ENSMUSE00000132163 Chr16:91651875..91652041 ATACGGAGCTGCGGTACAAG Chr16:91652018..91652037 60.29 55

*** Putative Vector Insertion (Chr 16: 91654855 - 91656949) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000248612 Chr16:91654856..91656948 ATTGTTACAACGGGCTCAGG Chr16:91655402..91655421 59.99 50
downstream ENSMUSE00000697861 Chr16:91654856..91660825 ATTGTTACAACGGGCTCAGG Chr16:91655402..91655421 59.99 50
downstream ENSMUSE00000248597 Chr16:91657069..91660825 CAGCGGGGGTTTTTACTACA Chr16:91658776..91658795 59.99 50
downstream ENSMUSE00000421977 Chr16:91662346..91662506 GGAGGTGCAGGCTTTAGGTT Chr16:91662445..91662464 60.63 55
downstream ENSMUSE00000697840 Chr16:91662737..91663553 CTCTTGGCGATCAGTGAACA Chr16:91662867..91662886 59.98 50
downstream ENSMUSE00000248551 Chr16:91664443..91664589 AAAATGGGCTTGGGTTCACT Chr16:91664579..91664598 60.72 45
downstream ENSMUSE00000248543 Chr16:91664879..91665067 TACTTGGCTTTTCGGTGGAG Chr16:91664920..91664939 60.24 50
downstream ENSMUSE00000718854 Chr16:91665165..91665953 CTGCAATTCGATGCTTTTCA Chr16:91665294..91665313 59.95 40
downstream ENSMUSE00000248535 Chr16:91670709..91670819 CCGTTCTTGAGCTCGGTTTA Chr16:91670822..91670841 60.38 50
downstream ENSMUSE00000555840 Chr16:91671594..91671710 GTGAACTGCCCAGGGATAGA Chr16:91671640..91671659 60.07 55
downstream ENSMUSE00000393322 Chr16:91675646..91675793 TCAAAACAGCTCCCATTCCT Chr16:91675700..91675719 59.67 45
downstream ENSMUSE00000248514 Chr16:91677650..91677721 CCAGAACGCTTTTGTGCTCT Chr16:91677692..91677711 60.57 50
downstream ENSMUSE00000248507 Chr16:91677834..91677949 AGAGGAAATGTTTGCGATGG Chr16:91677947..91677966 60.07 45
downstream ENSMUSE00000394089 Chr16:91678346..91679437 AAGTGGCATTAGCCATGAGG Chr16:91678534..91678553 60.1 50
downstream ENSMUSE00000716529 Chr16:91678346..91679466 AAGTGGCATTAGCCATGAGG Chr16:91678534..91678553 60.1 50
downstream ENSMUSE00000714116 Chr16:91678399..91679452 AAGTGGCATTAGCCATGAGG Chr16:91678534..91678553 60.1 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAAAGAGGCCTCCAGAAAA Chr16:91654860..91654880 59.93 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGACGTGACTGGGAAAACC Chr16:91654902..91654922 60.54 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000022961