Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25238
Trapped Gene
Mapk8 (ENSMUSG00000021936)
Vector Insertion
Chr 14: 34224041 - 34224164
Public Clones not available
Private Clones OST190754 (lexicon) OST183210 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000689836 (Chr14:34224042..34224180 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGAGCAGAAGCAAACGTGAC Chr14:34224143..34224162 60.18 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000689836 (Chr14:34224042..34224180 -)
Downstram Exon
ENSMUSE00000689834 (Chr14:34224042..34224163 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGAGCAGAAGCAAACGTGAC Chr14:34224143..34224162 60.18 50 GTCACGTTTGCTTCTGCTCA Chr14:34224121..34224140 60.18 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000440250 Chr14:34260201..34260314 GCCGCGAACAGGATTGAGTA Chr14:34260274..34260293 63.52 55
upstream ENSMUSE00000689839 Chr14:34260201..34260344 GCCGCGAACAGGATTGAGTA Chr14:34260274..34260293 63.52 55
upstream ENSMUSE00000689884 Chr14:34260201..34260331 GCCGCGAACAGGATTGAGTA Chr14:34260274..34260293 63.52 55
upstream ENSMUSE00000224580 Chr14:34224042..34224210 TGAGCAGAAGCAAACGTGAC Chr14:34224143..34224162 60.18 50
upstream ENSMUSE00000689834 Chr14:34224042..34224163 TGAGCAGAAGCAAACGTGAC Chr14:34224143..34224162 60.18 50
upstream ENSMUSE00000689836 Chr14:34224042..34224180 TGAGCAGAAGCAAACGTGAC Chr14:34224143..34224162 60.18 50
upstream ENSMUSE00000713801 Chr14:34224042..34224210 TGAGCAGAAGCAAACGTGAC Chr14:34224143..34224162 60.18 50

*** Putative Vector Insertion (Chr 14: 34224041 - 34224164) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000122256 Chr14:34221234..34221363 CGCTTAGCATGGGTCTGATT Chr14:34221258..34221277 60.24 50
downstream ENSMUSE00000561866 Chr14:34216051..34216109 GGGATTTCTGTGGTGTGAAA Chr14:34216048..34216067 58.39 45
downstream ENSMUSE00000122244 Chr14:34215810..34215948 GCAAAGATTTGCATCCATGA Chr14:34215890..34215909 59.63 40
downstream ENSMUSE00000561861 Chr14:34206128..34206293 TCACCACATAAGGCGTCATC Chr14:34206160..34206179 59.53 50
downstream ENSMUSE00000122264 Chr14:34203859..34203930 GGATTTTGTGGCAAACCATT Chr14:34203855..34203874 59.67 40
downstream ENSMUSE00000689852 Chr14:34203428..34203499 ATGCACCCAACTGACCAAAT Chr14:34203453..34203472 60.24 45
downstream ENSMUSE00000122260 Chr14:34201986..34202168 CACATCGGGGAACAGTTTCT Chr14:34202001..34202020 59.97 50
downstream ENSMUSE00000689833 Chr14:34201986..34202012 No primer for this exon
downstream ENSMUSE00000122258 Chr14:34200358..34200482 GGTGCTGGAGAGCTTCATCT Chr14:34200377..34200396 59.56 55
downstream ENSMUSE00000122262 Chr14:34199748..34199811 TAACTGCTTGTCCGGGATCT Chr14:34199760..34199779 59.69 50
downstream ENSMUSE00000122253 Chr14:34197060..34197137 AGTTCGTTCCTCCAAATCCA Chr14:34197075..34197094 59.53 45
downstream ENSMUSE00000689832 Chr14:34195494..34195510 No primer for this exon
downstream ENSMUSE00000689835 Chr14:34195356..34195510 TCGGATCTGTGGACATTGAA Chr14:34195403..34195422 60.05 45
downstream ENSMUSE00000224498 Chr14:34194235..34195505 TCGGATCTGTGGACATTGAA Chr14:34195403..34195422 60.05 45
downstream ENSMUSE00000689838 Chr14:34193982..34195505 TCGGATCTGTGGACATTGAA Chr14:34195403..34195422 60.05 45
downstream ENSMUSE00000689841 Chr14:34191084..34195510 GCAATGCTGAAGAGGGCTAC Chr14:34192153..34192172 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGAGCAGAAGCAAACGTGAC Chr14:34224141..34224161 60.18 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGCAGAAGCAAACGTGAC Chr14:34224141..34224161 60.18 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021936