Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25241
Trapped Gene
Exoc2 (ENSMUSG00000021357)
Vector Insertion
Chr 13: 31038293 - 31042048
Public Clones not available
Private Clones OST190594 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000660842 (Chr13:31042049..31042167 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000660842 (Chr13:31042049..31042167 -)
Downstram Exon
ENSMUSE00000660841 (Chr13:31038234..31038292 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000430965 Chr13:31065865..31065916 No primer for this exon
upstream ENSMUSE00000660842 Chr13:31042049..31042167 No primer for this exon

*** Putative Vector Insertion (Chr 13: 31038293 - 31042048) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000660841 Chr13:31038234..31038292 No primer for this exon
downstream ENSMUSE00000283541 Chr13:31032479..31032639 No primer for this exon
downstream ENSMUSE00000712511 Chr13:31032479..31032639 No primer for this exon
downstream ENSMUSE00000117289 Chr13:31029985..31030161 No primer for this exon
downstream ENSMUSE00000117295 Chr13:31027364..31027490 No primer for this exon
downstream ENSMUSE00000117290 Chr13:31019177..31019290 No primer for this exon
downstream ENSMUSE00000117305 Chr13:31017592..31017716 No primer for this exon
downstream ENSMUSE00000117294 Chr13:31003039..31003119 No primer for this exon
downstream ENSMUSE00000117298 Chr13:30998601..30998746 No primer for this exon
downstream ENSMUSE00000117303 Chr13:30998372..30998453 No primer for this exon
downstream ENSMUSE00000117291 Chr13:30997522..30997624 No primer for this exon
downstream ENSMUSE00000660839 Chr13:30992654..30992772 No primer for this exon
downstream ENSMUSE00000660838 Chr13:30978058..30978183 No primer for this exon
downstream ENSMUSE00000362665 Chr13:30974118..30974242 No primer for this exon
downstream ENSMUSE00000394695 Chr13:30969417..30969482 No primer for this exon
downstream ENSMUSE00000660837 Chr13:30969112..30969269 No primer for this exon
downstream ENSMUSE00000117292 Chr13:30968600..30968721 No primer for this exon
downstream ENSMUSE00000343596 Chr13:30967128..30967189 No primer for this exon
downstream ENSMUSE00000117293 Chr13:30964158..30964238 No primer for this exon
downstream ENSMUSE00000117297 Chr13:30963711..30963770 No primer for this exon
downstream ENSMUSE00000117287 Chr13:30962988..30963049 No primer for this exon
downstream ENSMUSE00000283384 Chr13:30959841..30959907 No primer for this exon
downstream ENSMUSE00000283373 Chr13:30956700..30956816 No primer for this exon
downstream ENSMUSE00000283364 Chr13:30948523..30948664 No primer for this exon
downstream ENSMUSE00000283356 Chr13:30917908..30917963 No primer for this exon
downstream ENSMUSE00000283349 Chr13:30914501..30914623 No primer for this exon
downstream ENSMUSE00000283341 Chr13:30912447..30912508 No primer for this exon
downstream ENSMUSE00000283334 Chr13:30909867..30909926 No primer for this exon
downstream ENSMUSE00000660836 Chr13:30905788..30907260 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAAGCAAATAATCGCCTTGC Chr13:31038985..31039005 59.82 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACACACGTGACTGGGAAAAC Chr13:31038982..31039002 58.46 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021357