Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25246
Trapped Gene
2310065K24Rik (ENSMUSG00000031774)
Vector Insertion
Chr 8: 97106915 - 97111223
Public Clones not available
Private Clones OST190458 (lexicon)
Severity of mutation (?) Insertion after 46% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000580890 (Chr8:97111224..97111345 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGCGGCGAGAAGAAGAACTA Chr8:97111245..97111264 59.36 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000580890 (Chr8:97111224..97111345 -)
Downstram Exon
ENSMUSE00000580888 (Chr8:97106784..97106914 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGCGGCGAGAAGAAGAACTA Chr8:97111245..97111264 59.36 50 AGCTTTGCCTGGGAGAACTT Chr8:97106789..97106808 60.38 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000349021 Chr8:97125397..97125579 AAGCCGTCGTTCTTTTCTTG Chr8:97125498..97125517 59.49 45
upstream ENSMUSE00000334136 Chr8:97113211..97113307 AAAGCGCCTTGAGTACCTGA Chr8:97113248..97113267 60.01 50
upstream ENSMUSE00000212879 Chr8:97112676..97112813 GGAGAAAGTGCGAAAACCAG Chr8:97112688..97112707 59.85 50
upstream ENSMUSE00000212877 Chr8:97111903..97112001 ATGTCCAGAGGAGGCGTATG Chr8:97111981..97112000 60.1 55
upstream ENSMUSE00000580890 Chr8:97111224..97111345 AGCGGCGAGAAGAAGAACTA Chr8:97111245..97111264 59.36 50

*** Putative Vector Insertion (Chr 8: 97106915 - 97111223) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000580888 Chr8:97106784..97106914 AGCTTTGCCTGGGAGAACTT Chr8:97106789..97106808 60.38 50
downstream ENSMUSE00000212881 Chr8:97103300..97103364 No primer for this exon
downstream ENSMUSE00000399964 Chr8:97098843..97099757 AGGTGTTGGTTCGGAAGATG Chr8:97099532..97099551 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGATGGAATGTCAGTCAG Chr8:97108214..97108234 59.47 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGATGGAATGTCAGTCAG Chr8:97108214..97108234 59.47 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031774