Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25268
Trapped Gene
Lrrc23 (ENSMUSG00000030125)
Vector Insertion
Chr 6: 124726219 - 124728109
Public Clones not available
Private Clones OST189788 (lexicon) OST128310 (lexicon)
Severity of mutation (?) Insertion after 47% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000195521 (Chr6:124728110..124728363 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATATCGCCGCTCAACAGTCT Chr6:124728265..124728284 59.87 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000195521 (Chr6:124728110..124728363 -)
Downstram Exon
ENSMUSE00000195526 (Chr6:124726088..124726218 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATATCGCCGCTCAACAGTCT Chr6:124728265..124728284 59.87 50 GTGCAGGCTCGACAGTCTCT Chr6:124726141..124726160 60.77 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000247729 Chr6:124729668..124729736 AACAGTCTTGGCGTCTCAGC Chr6:124729712..124729731 60.6 55
upstream ENSMUSE00000691799 Chr6:124729668..124729745 AACAGTCTTGGCGTCTCAGC Chr6:124729712..124729731 60.6 55
upstream ENSMUSE00000247723 Chr6:124729030..124729193 GACGTTGATGCAGAACAGGA Chr6:124729103..124729122 59.84 50
upstream ENSMUSE00000691798 Chr6:124729030..124729164 GACGTTGATGCAGAACAGGA Chr6:124729103..124729122 59.84 50
upstream ENSMUSE00000195524 Chr6:124728835..124728944 GTGGACTGGCTCACGCTTAT Chr6:124728858..124728877 60.28 55
upstream ENSMUSE00000195521 Chr6:124728110..124728363 ATATCGCCGCTCAACAGTCT Chr6:124728265..124728284 59.87 50

*** Putative Vector Insertion (Chr 6: 124726219 - 124728109) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000195526 Chr6:124726088..124726218 GTGCAGGCTCGACAGTCTCT Chr6:124726141..124726160 60.77 60
downstream ENSMUSE00000195527 Chr6:124724364..124724500 GGTGGTCAAGTTGCTCAGGT Chr6:124724422..124724441 60.16 55
downstream ENSMUSE00000195522 Chr6:124720590..124720893 ACTGGTGGCAAGTACGGTTC Chr6:124720602..124720621 60.03 55
downstream ENSMUSE00000691796 Chr6:124719888..124720181 CCCCCACTGGAGTCTTATCA Chr6:124720113..124720132 59.92 55
downstream ENSMUSE00000247683 Chr6:124719881..124720181 CCCCCACTGGAGTCTTATCA Chr6:124720113..124720132 59.92 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGATCTCAAAGGTGGGTCCT Chr6:124728099..124728119 60.31 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGATCTCAAAGGTGGGTCCT Chr6:124728099..124728119 60.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030125