Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25269
Trapped Gene
Sema4d (ENSMUSG00000021451)
Vector Insertion
Chr 13: 51888865 - 51889014
Public Clones not available
Private Clones OST189778 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000682484 (Chr13:51888866..51889042 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000682484 (Chr13:51888866..51889042 -)
Downstram Exon
ENSMUSE00000456494 (Chr13:51888866..51889013 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000456494 Chr13:51888866..51889013 No primer for this exon
upstream ENSMUSE00000682484 Chr13:51888866..51889042 No primer for this exon

*** Putative Vector Insertion (Chr 13: 51888865 - 51889014) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000456461 Chr13:51858621..51858689 No primer for this exon
downstream ENSMUSE00000682477 Chr13:51829876..51830132 No primer for this exon
downstream ENSMUSE00000682483 Chr13:51829876..51829939 No primer for this exon
downstream ENSMUSE00000117975 Chr13:51820593..51820911 No primer for this exon
downstream ENSMUSE00000710426 Chr13:51820593..51820911 No primer for this exon
downstream ENSMUSE00000117967 Chr13:51818912..51819057 No primer for this exon
downstream ENSMUSE00000117965 Chr13:51817687..51817749 No primer for this exon
downstream ENSMUSE00000117966 Chr13:51815875..51815973 No primer for this exon
downstream ENSMUSE00000117987 Chr13:51810163..51810256 No primer for this exon
downstream ENSMUSE00000240101 Chr13:51809061..51809174 No primer for this exon
downstream ENSMUSE00000240094 Chr13:51808048..51808199 No primer for this exon
downstream ENSMUSE00000117973 Chr13:51806818..51806993 No primer for this exon
downstream ENSMUSE00000117985 Chr13:51806569..51806725 No primer for this exon
downstream ENSMUSE00000117983 Chr13:51805281..51805503 No primer for this exon
downstream ENSMUSE00000117962 Chr13:51804244..51804359 No primer for this exon
downstream ENSMUSE00000117969 Chr13:51800442..51800614 No primer for this exon
downstream ENSMUSE00000117960 Chr13:51800322..51800365 No primer for this exon
downstream ENSMUSE00000682482 Chr13:51796619..51798900 No primer for this exon
downstream ENSMUSE00000347150 Chr13:51796617..51798900 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATCGCCTTGCAGCACATC Chr13:51888943..51888963 62.25 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000021451