Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25270
Trapped Gene
Surf4 (ENSMUSG00000014867)
Vector Insertion
Chr 2: 26782476 - 26788794
Public Clones E127A05 (ggtc)
Private Clones OST189715 (lexicon) OST57409 (lexicon) OST15607 (lexicon)
Severity of mutation (?) Insertion after 6% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000410438 (Chr2:26788795..26788927 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000410438 (Chr2:26788795..26788927 -)
Downstram Exon
ENSMUSE00000232711 (Chr2:26782289..26782475 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000410438 Chr2:26788795..26788927 No primer for this exon

*** Putative Vector Insertion (Chr 2: 26782476 - 26788794) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000232711 Chr2:26782289..26782475 No primer for this exon
downstream ENSMUSE00000164203 Chr2:26781128..26781204 No primer for this exon
downstream ENSMUSE00000164200 Chr2:26780473..26780516 No primer for this exon
downstream ENSMUSE00000164202 Chr2:26779865..26780051 No primer for this exon
downstream ENSMUSE00000383033 Chr2:26775561..26777691 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGGGACAGAACGACCTGATG Chr2:26782820..26782840 62.11 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGGGACAGAACGACCTGATG Chr2:26782820..26782840 62.11 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 CCATGATGCATTGGAGACCT Chr2:26782957..26782977 60.89 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GCTGAGGTGTGAGAACGTGA Chr2:26782872..26782892 60.03 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014867