Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25279
Trapped Gene
Eif2s3y (ENSMUSG00000069049)
Vector Insertion
Chr Y: 359918 - 364630
Public Clones IST11354E7 (tigm)
Private Clones OST189396 (lexicon)
Severity of mutation (?) Insertion after 94% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000568604 (ChrY:359745..359917 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAATTGCTCTAAGCCGACGA ChrY:359881..359900 59.98 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000568604 (ChrY:359745..359917 +)
Downstram Exon
ENSMUSE00000568603 (ChrY:364631..365035 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAATTGCTCTAAGCCGACGA ChrY:359881..359900 59.98 45 TATCTGGCCCCAACCAATTA ChrY:364655..364674 60.15 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000568624 ChrY:347055..347128 CGCATCTTTCTCGTCAGGAT ChrY:347097..347116 60.36 50
upstream ENSMUSE00000568623 ChrY:347703..347766 ACCAAGTTGACTCCGCTTTC ChrY:347709..347728 59.33 50
upstream ENSMUSE00000568621 ChrY:348283..348410 GCACAATTGGTCATGTTGCT ChrY:348283..348302 59.58 45
upstream ENSMUSE00000568620 ChrY:348491..348612 TCAAGTTGTCCTCGACCAGA ChrY:348509..348528 59.39 50
upstream ENSMUSE00000568619 ChrY:349822..349916 TGATGGCAACTATGCTGAATG ChrY:349860..349880 59.7 42.86
upstream ENSMUSE00000568618 ChrY:351077..351235 TGGCTGCCATTGAAATTATG ChrY:351119..351138 59.52 40
upstream ENSMUSE00000568614 ChrY:352500..352634 No primer for this exon
upstream ENSMUSE00000568611 ChrY:353033..353127 CCTGGCTGTGAAGTTGATGA ChrY:353059..353078 59.83 50
upstream ENSMUSE00000568610 ChrY:353807..353951 TCAGTATGCTGCTCCAGGTG ChrY:353923..353942 60.01 55
upstream ENSMUSE00000568606 ChrY:356429..356598 ATGCCGAGCAGATAGAATGG ChrY:356457..356476 60.2 50
upstream ENSMUSE00000568604 ChrY:359745..359917 AAATTGCTCTAAGCCGACGA ChrY:359881..359900 59.98 45

*** Putative Vector Insertion (Chr Y: 359918 - 364630) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000568603 ChrY:364631..365035 TATCTGGCCCCAACCAATTA ChrY:364655..364674 60.15 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCTTCTGATAATCGCCTTGC ChrY:359961..359981 59.95 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTGCTCTAAGCCGACGAGTT ChrY:359885..359905 60.15 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000069049