Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25301
Trapped Gene
Ppp2cb (ENSMUSG00000009630)
Vector Insertion
Chr 8: 34721337 - 34722219
Public Clones not available
Private Clones OST188459 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000582550 (Chr8:34721127..34721336 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000582550 (Chr8:34721127..34721336 +)
Downstram Exon
ENSMUSE00000582549 (Chr8:34722220..34722393 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000433955 Chr8:34710097..34710490 No primer for this exon
upstream ENSMUSE00000582550 Chr8:34721127..34721336 No primer for this exon

*** Putative Vector Insertion (Chr 8: 34721337 - 34722219) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000582549 Chr8:34722220..34722393 No primer for this exon
downstream ENSMUSE00000210960 Chr8:34725922..34726011 No primer for this exon
downstream ENSMUSE00000210958 Chr8:34726138..34726299 No primer for this exon
downstream ENSMUSE00000582548 Chr8:34727499..34727617 No primer for this exon
downstream ENSMUSE00000410274 Chr8:34729594..34730266 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGTGAACTTCAAAGGCAAA Chr8:34721361..34721381 60.09 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCAAAGGCAAAAGAATGTCG Chr8:34721369..34721390 60.23 38.1 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000009630