Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI25306
Trapped Gene
Megf11 (ENSMUSG00000036466)
Vector Insertion
Chr 9: 64349329 - 64349431
Public Clones not available
Private Clones OST188193 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000714229 (Chr9:64349330..64349430 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGACCCCAATGTGTGTAGCC Chr9:64349401..64349420 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000714229 (Chr9:64349330..64349430 +)
Downstram Exon
ENSMUSE00000712792 (Chr9:64349330..64349430 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGACCCCAATGTGTGTAGCC Chr9:64349401..64349420 59.85 55 GGCTACACACATTGGGGTCT Chr9:64349423..64349442 59.85 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000720706 Chr9:64233433..64233635 TGCTCACTCGTTCTCAGTGC Chr9:64233485..64233504 60.34 55
upstream ENSMUSE00000532794 Chr9:64233493..64233635 No primer for this exon
upstream ENSMUSE00000584223 Chr9:64233497..64233635 No primer for this exon

*** Putative Vector Insertion (Chr 9: 64349329 - 64349431) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000712792 Chr9:64349330..64349430 GGCTACACACATTGGGGTCT Chr9:64349423..64349442 59.85 55
downstream ENSMUSE00000714229 Chr9:64349330..64349430 GGCTACACACATTGGGGTCT Chr9:64349423..64349442 59.85 55
downstream ENSMUSE00000718313 Chr9:64349330..64349430 GGCTACACACATTGGGGTCT Chr9:64349423..64349442 59.85 55
downstream ENSMUSE00000636171 Chr9:64353835..64353936 ATCTGATCAAAGGGGTGTGC Chr9:64353885..64353904 59.93 50
downstream ENSMUSE00000697286 Chr9:64353835..64353936 ATCTGATCAAAGGGGTGTGC Chr9:64353885..64353904 59.93 50
downstream ENSMUSE00000636169 Chr9:64356515..64356615 TGCAGAAGTCTCCGTTCTCA Chr9:64356615..64356634 59.7 50
downstream ENSMUSE00000697284 Chr9:64356515..64356615 TGCAGAAGTCTCCGTTCTCA Chr9:64356615..64356634 59.7 50
downstream ENSMUSE00000419217 Chr9:64392401..64392493 CATGCACTCCTCGGTACACA Chr9:64392426..64392445 60.74 55
downstream ENSMUSE00000697283 Chr9:64392401..64392493 CATGCACTCCTCGGTACACA Chr9:64392426..64392445 60.74 55
downstream ENSMUSE00000636167 Chr9:64486042..64486288 GAGTACCAGGAGCGCAGAGT Chr9:64486191..64486210 59.63 60
downstream ENSMUSE00000697281 Chr9:64486042..64486288 GAGTACCAGGAGCGCAGAGT Chr9:64486191..64486210 59.63 60
downstream ENSMUSE00000636166 Chr9:64487821..64487941 No primer for this exon
downstream ENSMUSE00000697280 Chr9:64487821..64487941 No primer for this exon
downstream ENSMUSE00000584238 Chr9:64495622..64495758 AGTGGCATTGTCCAGTCACA Chr9:64495736..64495755 60.16 50
downstream ENSMUSE00000697278 Chr9:64495622..64495758 AGTGGCATTGTCCAGTCACA Chr9:64495736..64495755 60.16 50
downstream ENSMUSE00000584237 Chr9:64500877..64501089 GGCTGGTGAACATTGACCTC Chr9:64500967..64500986 60.52 55
downstream ENSMUSE00000697274 Chr9:64500877..64501089 GGCTGGTGAACATTGACCTC Chr9:64500967..64500986 60.52 55
downstream ENSMUSE00000584236 Chr9:64508147..64508321 CAACCGTTGCCATAGTAGCC Chr9:64508245..64508264 60.52 55
downstream ENSMUSE00000697272 Chr9:64508147..64508321 CAACCGTTGCCATAGTAGCC Chr9:64508245..64508264 60.52 55
downstream ENSMUSE00000584235 Chr9:64526986..64527106 No primer for this exon
downstream ENSMUSE00000584234 Chr9:64528041..64528204 TTGGCACAGATGCAAGTCTC Chr9:64528125..64528144 59.99 50
downstream ENSMUSE00000584233 Chr9:64529197..64529299 ACTGCAGTTCAGCCCAAAAG Chr9:64529226..64529245 60.43 50
downstream ENSMUSE00000584232 Chr9:64533687..64533833 ACCTGGAGGACACGTGCTAT Chr9:64533721..64533740 59.6 55
downstream ENSMUSE00000584231 Chr9:64534170..64534304 GTAGAATCCTGGTGGGCAGA Chr9:64534192..64534211 60.07 55
downstream ENSMUSE00000636161 Chr9:64537809..64537937 CATTGTTGGCACAGGAACAG Chr9:64537871..64537890 60.15 50
downstream ENSMUSE00000627326 Chr9:64539028..64539156 TGCAGAAGAGTCCAGTCCAG Chr9:64539153..64539172 59.12 55
downstream ENSMUSE00000636160 Chr9:64539602..64539730 AGCTGGCTCCATTCTGACAC Chr9:64539670..64539689 60.42 55
downstream ENSMUSE00000636159 Chr9:64540162..64540290 TGCTGACACCCATATCCAAA Chr9:64540201..64540220 59.92 45
downstream ENSMUSE00000636158 Chr9:64541568..64541804 AGGTCACGGCCTTTCTCTTT Chr9:64541745..64541764 60.25 50
downstream ENSMUSE00000584226 Chr9:64543171..64543289 GGTAGCTGGCATTGGAAAAG Chr9:64543224..64543243 59.71 50
downstream ENSMUSE00000584225 Chr9:64545114..64545180 CATAGCTGTAGGGGGTCCAG Chr9:64545171..64545190 59.57 60
downstream ENSMUSE00000335206 Chr9:64545614..64545715 CAGGGCACTGATCTGGAAAT Chr9:64545642..64545661 60.07 50
downstream ENSMUSE00000697311 Chr9:64547904..64547960 TCTGACGTCTGTCCATTCCA Chr9:64547933..64547952 60.25 50
downstream ENSMUSE00000584222 Chr9:64548170..64548761 GCACTTCCCATCCGACTTTA Chr9:64548753..64548772 60.07 50
downstream ENSMUSE00000419235 Chr9:64553534..64557012 CAGTCCCGTTTGGAAGTGTT Chr9:64554648..64554667 60.01 50
downstream ENSMUSE00000419239 Chr9:64553534..64553740 GGGTCCTTAATTGTGGCGTA Chr9:64553618..64553637 59.82 50
downstream ENSMUSE00000627316 Chr9:64554334..64554491 GGCAGGGCTCTGTCTTACTG Chr9:64554467..64554486 60.01 60
downstream ENSMUSE00000713911 Chr9:64554334..64555097 CAGTCCCGTTTGGAAGTGTT Chr9:64554648..64554667 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGTAATCGCCTTGCAGCAC Chr9:64349377..64349397 60.42 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTCCTTGTCTTCCTTCTG Chr9:64349356..64349376 59.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000036466